Overview

Distribution

Range Description

Found in eastern Brazil from the states of Pará south to Santa Catarina (Gardner 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
In the Atlantic forest of Brazil this species was found to make nests in the forks of trees or in bushes. In the Brazilian cerrado it is restricted to gallery forest and is found to be terrestrial and active during the day. Their activity is predominantly terrestrial and crepuscular. Found usually near water. Feeds on insects; in captivity will voraciously kill and eat small vertebrates (Eisenberg and Redford, 1999; Emmons and Feer, 1997).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Monodelphis americana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTACCTATTATTTGGCGCCTGAGCAGGTATAGTAGGTACCGCATTAAGCCTACTCATTCGAGCAGAACTAGGTCAACCAGGGACTCTCATTGGTGATGATCAAATTTATAATGTTATTGTGACTGCTCACGCTTTTGTTATAATTTTCTTTATAGTTATACCTATTATGATCGGGGGTTTTGGTAATTGATTAGTGCCTCTAATAATTGGAGCCCCAGATATGGCATTCCCTCGAATAAATAATATAAGTTTCTGACTATTACCCCCCTCATTCCTTCTCCTACTAGCATCATCCACTATTGAAGCAGGGGCTGGAACAGGTTGAACTGTATATCCACCTCTAGCCGGCAATCTAGCTCACGCAGGAGCTTCAGTAGACCTAGCAATCTTTTCACTCCACTTAGCCGGAATTTCATCTATTTTAGGAGCAATTAACTTTATTACTACTATTATTAATATAAAACCCCCAGCAATATCTCAATACCAAACCCCATTATTTGTTTGATCAGTTATAATCACAGCCGTACTCCTACTACTATCACTTCCAGTCCTAGCTGCAGGTATTACTATATTGTTAACTGACCGAAACTTAAATACTACTTTCTTTGACCCAGCGGGAGGGGGTGGTCCTATTCTATATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Monodelphis americana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Brito, D. & Astua de Moraes, D.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, it occurs in a number of protected areas, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is uncommon.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
No major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Occurs in a number of protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Northern three-striped opossum

The northern three-striped opossum, Monodelphis americana, is an opossum species from South America. It is found in Brazil.

References

  1. ^ Gardner, A. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 13-14. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3.
  2. ^ Brito, D. & Astua de Moraes, D. (2008). Monodelphis americana. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 28 December 2008. Database entry includes justification for why this species is of least concern
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!