Overview

Brief Summary

Biology

The Visayan spotted deer is thought to be mainly nocturnal, emerging at dusk to begin feeding on a variety of different types of grasses, leaves and buds within the forest (2). These deer are social animals, usually found in small groups of three to five (7), but their mating system is poorly understood (3). In other members of the genus, mating is usually polygynous, with males competing for access to females through sparring and vocalisations (3). The breeding season of Visayan spotted deer is reported from November to December, although possibly beginning earlier, during which males produce a distinctive roar-like call (4). Young are born in May and June, after a gestation period of around 240 days (3). Offspring are weaned at six months and reach maturity from 12 months of age, at which point males begin to grow antlers (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This small, short-legged deer is the largest endemic species of the west Visayan islands of the Philippines (2), and is easily distinguished from other Philippine deer by the distinctive pattern of buff-coloured spots scattered across its dark brown back and sides (2) (3). The underparts are a creamy colour with white fur on the chin and lower lip, contrasting sharply with the otherwise deep brown face and neck (3). The head is a slightly lighter shade of brown than the body, and the eyes are surrounded by a ring of paler fur (2). As is typical of most cervids, only males bear antlers, which are bumpy and relatively short and stout at around 20 centimetres in length (2). Males can also be distinguished from females by their much larger overall size (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is endemic to the Western Visayan Islands (or Negros-Panay Faunal Region) of the central Philippines. The species was previously found on Panay, Guimaras, Negros, Cebu, Masbate and probably Ticao Islands (Heaney et al. 1998; Grubb 2005; Oliver 1993a, 1996). Presently, the species is restricted to the Mount Madja - Mount Baloy area of west Panay and a few scattered remnants of forest on Negros (Cox 1987; Oliver et al. 1992). It was extirpated on Cebu in the mid-twentieth century. A few individuals were reported to survive on Masbate between 1991 and 1993, but the population there is almost certainly extinct or ‘functionally extinct’. It is not known whether R. alfredi or R. mariannus occurred formerly on Siquijor, where no deer now survive, but this species is replaced by R. mariannus on Bohol and all other larger Philippine Islands east of Huxley’s Line (i.e. excluding Palawan) (Grubb 2005; Oliver 1993a, 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Rusa alfredi is found only on the Visayan Islands, which are located in the central Philippines. This is one of the rarest, least known, and most narrowly disributed species of deer in the world. Formerly R. alfredi inhabited the larger Visayan Islands of Panay, Negros, Cebu, Guimaras, Leyte, and Samar. Now it is only thought to be found in three to four remaining patches of forest on the islands of Panay and Negros.

Biogeographic Regions: oriental (Native ); oceanic islands (Native )

Other Geographic Terms: island endemic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
Philippines

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Endemic to the Visayan islands of the central Philippines, formerly reported on Cebu, Guimaras, Leyte, Masbate, Negros, Panay, and Samar, but now thought to remain only on the islands of Panay and Negros (1) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Visayan spotted deer have a fine, dense, and soft dark-brown coat on their upper body. They have spots on their backs and flanks, which they retain throughout their life. They have pale white fur on the underside as well as on the chin and lower lip.

Visayan spotted deer are small, the shoulder height of a mature deer is around 75 to 80 cm. Females are much smaller than the males. The ears and tail are relatively short.

Range mass: 36 to 59 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

  • Kurt, F. 1990. Grizimeks Encyclopedia of Mammals. New York: McGraw-Hill Publishing Co..
  • Whitehead, K. 1993. The Whitehead Encyclopedia of Deer. Stillwater, MN: Swan Hill Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species formerly occurred from sea-level to at least 2,000 m asl in primary forest and second growth. It can persist in some degraded habitats such as cogon grasslands as long as there are areas of dense cover. The preferred habitat of this species is not clear, since it is now restricted to steep, rugged slopes of dipterocarp forest that are innaccessible to humans (Cox, 1987). It was known to rely on dense forest for refuge (Rabor, 1977), but also frequents open grassy patches and secondary communities. Rabor (1977) reports that the main constituents of their diet are young shoots of cogon grass (found in clearings) and young low-growing leaves and buds within forests. It is predominately a browser, but also a grazer (captive animals also relish fruit). They also visit burnt forest clearings for the mineral content of floral ash, as well as the pioneering shoots. All local reports indicate an average group size of one to three individuals - mostly solitary males and females with single young – though it remains unclear whether or not these small group sizes are a function of continued and sustained hunting pressure, particularly as much larger numbers of individuals have been maintained peacefully together in captivity for indefinite periods (W. Oliver, pers. obs.). The species breeds year round in captivity and young animals are reported to be captured in the wild at all times of the year.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Visayan spotted deer are most common in the dense interior of the islands. At one time they could be found in larger numbers from sea level to the tops of the mountains throughout the islands. The interiors of the islands are composed of thick rugged tropical forests that range from 750 to 1,000 meters in elevation. The mountains are drained by a series of short violent streams. Visayan spotted deer prefer areas that have undergone a natural disturbance such as fires or landslides. This opens up the canopy allowing the growth of tender plants close to the ground.

A survey in 1991 found that Visayan spotted deer had been extirpated over 95% of its range. The forests are cleared at an excruciating pace by landless peasants and families that were forced into the forest by the collapsing sugar and logging industry. The land that Visayan spotted deer once wandered is now used for farming then abandoned, causing the need for more forest to be cleared. The abandoned agricultural plots are slow to regenerate a secondary forest because of lack of nutrients available in the soil.

Range elevation: 750 to 1000 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest ; mountains

  • Heaney, L., J. Regalado. 1998. Vanishing Treasures of the Philippine Rain Forest. Chicago: The Field Museum.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Visayan spotted deer inhabits primary rainforest and secondary growth, from sea level up to at least 1,500 metres above sea level (5) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Visayan spotted deer are herbivores with a diet that includes a wide variety of vegetation. The deer prefer the succulent vegetation that emerges after fires, landslides and other natural disasters.

Plant Foods: leaves; wood, bark, or stems

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

It is difficult to speculate on the role that this rare species may play within its ecosystem. Surely, its browsing behavior has some influence on plant communities. It is likely that these deer are able to keep disturbed areas open for longer periods of time by eating down new vegetation. It is also likely that they influence the pattern of ecological succession in the areas of disturbance throught their foraging behavior, probably prefering some types of forage over others.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

The main predators of Visayan spotted deer are Homo sapiens, (humans). The peasants and other unemployed natives that inhabit the surrounding forest have resorted to hunting as a means of survival. Visayan spotted deer are a protected species but the remoteness of their habitat makes guard patrols very difficult. This puts an increasing pressure on small populations that remain. During the dry season, which is from January until June, hunting pressure is at its highest.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Cervus alfredi is prey of:
Homo sapiens

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

During the rutting season stag deer will roar. Males are likely to have some physical interactions during the competition associated with rut, if these deer are like other cervids. There are likely some visual and chemical communications from females to males, indicating their estrous status.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

It is not known how long Visayan spotted deer live. Related deer species can live a maximum of 12-17 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 18.5 years (captivity) Observations: One wild born specimen was about 18-19 years old when it died in captivity (Richard Weigl 2005). Similar species live over 20 years, so it is possible that maximum longevity is slightly underestimated in these animals.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The mating system of these deer is not known. However, in other, related deer, the most common mating system is polygyny. Males compete with one another for access to estrous females. Competition often involves sparring and vocalizing. Successful males are typically older and larger, and able to drive away younger, smaller males. These successful males are the ones who mate with the females. It is likely that Visayan spotted deer have a similar mating system.

Mating System: polygynous

The breeding season (rut) of Visayan spotted deer takes place from November to December. Following the breeding season there is a 240 day gestation period, with births in May and June.

Breeding interval: Visayan spotted deer breed once yearly.

Breeding season: Breeding occurs in November and December.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Average gestation period: 8 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Information on the parental care of R. alfredi is not available. In most cervids, parental care is strictly by females. Females give birth to one, sometimes two, offspring. The period of nursing lasts from a few weeks to a few months. Young may stay with their mothers past the time of weaning.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Nowak, R. 1999. Walker's Mammals of the World. Baltimore, Maryland: The Johns Hopkins University Press.
  • Whitehead, K. 1993. The Whitehead Encyclopedia of Deer. Stillwater, MN: Swan Hill Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rusa alfredi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTTTCAACTAACCATAAAGATATCGGCACTCTATATCTATTATTTGGTGCCTGAGCAGGCATAGTAGGAACAGCTTTAAGCCTGCTAATCCGTGCCGAACTGGGCCAACCCGGTACTCTGCTTGGAGATGACCAAATTTATAATGTTATTGTAACCGCACATGCATTCGTAATAATTTTCTTCATAGTTATGCCAATTATAATTGGAGGATTTGGTAATTGACTAGTCCCCCTAATAATCGGTGCCCCAGACATAGCATTTCCTCGAATAAACAATATAAGCTTTTGACTCCTCCCTCCTTCTTTCTTACTACTTTTAGCATCATCTATAGTTGAAGCTGGCACAGGAACAGGCTGAACTGTATATCCCCCTCTAGCTGGCAACTTAGCTCACGCAGGAGCTTCAGTAGACTTAACTATTTTTTCTTTACACCTGGCAGGTGTCTCCTCAATTCTAGGGGCCATTAACTTTATTACAACGATTATCAATATAAAACCTCCTGCTATATCACAATATCAAACCCCCTTATTTGTGTGATCCGTATTAGTCACTGCTGTATTACTACTTCTCTCACTCCCTGTACTAGCAGCCGGAATTACAATACTATTAACAGACCGAAACTTAAATACAACCTTTTTTGACCCAGCAGGAGGCGGAGACCCTATTCTATACCAACATTTGTTCTGATTCTTTGGTCACCCTGAAGTATATATCCTTATTCTACCCGGCTTTGGTATAATTTCCCATATCGTAACATACTACTCAGGAAAAAAAGAACCATTTGGGTACATAGGAATAGTCTGGGCTATGATATCAATTGGGTTTTTAGGATTTATCGTATGGGCCCACCATATATTTACAGTCGGAATAGATGTTGATACACGAGCCTATTTCACATCAGCTACCATAATTATTGCTATCCCAACTGGAGTAAAAGTCTTTAGTTGATTAGCAACACTCCACGGAGGTAATATCAAATGATCACCTGCTATAATATGAGCTTTAGGCTTTATTTTCCTTTTCACAGTTGGAGGCTTAACCGGGATTGTTCTTGCCAATTCTTCTCTCGACATTGTCCTTCATGACACATACTATGTAGTTGCACACTTCCACTATGTACTGTCAATAGGAGCTGTATTCGCTATTATGGGAGGTTTTGTTCACTGATTCCCATTATTCTCAGGGTATACTCTTAATGACACATGAGCCAAAATCCACTTTGTAATTATATTTGTAGGTGTAAATATAACTTTCTTTCCACAACACTTCCTAGGATTATCTGGCATGCCACGACGCTACTCTGATTATCCAGATGCATACACAATATGAAATACCATTTCATCCATAGGCTCATTTATTTCTCTGACAGCAGTTATATTAATAATCTTTATTATCTGAGAAGCATTTGCGTCCAAACGAGAAGTCTCAACCGTAGAACTAACAACAACAAACTTAGAATGACTAAATGGATGCCCTCCACCATATCATACATTTGAAGAACCTACATACGTCAACTTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rusa alfredi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
C2a(i)

Version
3.1

Year Assessed
2008

Assessor/s
Oliver, W., MacKinnon, J., Heaney, L. & Lastica, E.

Reviewer/s
Black, P.A. & Gonzalez, S. (Deer Red List Authority)

Contributor/s

Justification
Listed as Endangered because its population size is estimated to number fewer than 2,500 mature individuals, there is an observed continuing decline in the number of mature individuals, and no subpopulation is likely to contain more than 250 mature individuals.

History
  • 1996
    Endangered
    (Baillie and Groombridge 1996)
  • 1996
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 09/01/1988
Lead Region: Foreign (Region 10) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Cervus alfredi , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Visayan spotted deer are one of the most endangered deer in the world. There are thought to be only a few hundred wild individuals still in existence. This also makes it one of the most endangered mammals in the world. It has a rating of B1 2c on the IUCN categories for critically endangered species. The rating B1 stands for area of occupancy of less than 10 sq km and found in severely fragmented groups. The rating 2c stands for the continuing decline in the quality of habitat. A captive-breeding program was started in 1990 between the Mulhouse Zoo, France and the Philippine Department of Environmental and Natural Resources. The program has grown to three local breeding centers and a number of zoos’s worldwide. The program started with 13 Visayan Deer registered in the international studbook and has since grown to almost 80 registered deer. This species is not listed on any CITES appendix.

US Federal List: endangered

CITES: no special status

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The species is considered to be rare throughout its present, limited range. Populations are severely fragmented and declining, although the species is evidently able to utilise a wide variety of habitats. Currently, the species is estimated to have been extirpated from at 95% to 98% of its former range (Oliver et al., 1991; 1996). There is no global estimate of the population size, but it is reasonable to suppose that it is less than 2,500 mature individuals.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species has declined primarily as a result of habitat conversion (agriculture and logging) and hunting (Cox 1987; Oliver et al., 1991; Oliver 1992). Despite being fully protected by law, this species is still intensively hunted throughout its remaining range; both by local farmers in hinterland communities and recreational hunters from larger cities; both of which groups use the species as game (for meat and trophies), rather than for subsistence purposes (Cox, 1987; Evans et al., 1993; Oliver, 1994; Oliver et al., 1992). Both of these groups may also sell any surplus meat as venison in local markets or to speciality restaurants; whereas local hunters from upland communities also specialize in live-captures to meet strong demand for these animals as pets (particularly amongst local politicians). Many of these are supplied by the orphans of hunter-killed animals, though almost all such captive stocks also include animals captured as adults in leg snares, as evinced by the amputation of their lower limbs.

There is continuing severe habitat fragmentation and reduction of populations from illegal logging and agricultural expansion, and some populations are now so reduced in size as to be of doubtful viability. Hybridization with R. mariannus has been repeatedly observed amongst poorly (i.e. unscientifically) managed captive stocks of these two species, but (and despite previously published fears to the contrary) is most unlikely to pose any additional threats to the few surviving populations of R. alfredi given the evident allopatry in the natural ranges of these two species (Cox, 1987; Oliver et al., 1991; Oliver 1993a, 1996, unpubl.)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Visayan spotted dear is one of the rarest and most narrowly distributed mammals in the world, with only a few hundred wild animals thought to remain (3). Indeed, a survey in 1991 found that the species had already become extinct in over 95 percent of its former range, largely as a result of intensive hunting and extensive deforestation (4), with land having been cleared for agriculture and logging operations at a frightening pace (5). Hunting also poses a significant threat to this Endangered deer (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is fully protected under Philippine law, but effective enforcement is wanting in most in most areas. A number of new protected areas have been established within the range of the species, but management and enforcement likewise remains ineffective in most (perhaps all) such areas. Awareness levels have increased greatly; unfortunately, this has not yet lead to a change in behaviour in terms of hunting pressure. The species occurs in small populations in several protected areas: Mount Canlaon National Park (8,000 ha); North Negros Forest Reserve (c. 18,000 ha); Mount Talinis/Lake Balinsasayao Reserve (c. 11,000 ha); and the proposed West Panay Mountains National Park (c. 70,000 ha). However, the formal declaration of the latter area was eventually stymied by lack of unanimity amongst relevant local government units and a number of separate, smaller areas have since been declared, though these do not cover all of the most important sites, nor have any of these areas been significantly better protected since declaration owing the absence of any corresponding national budgetary allocations. Small numbers of individuals are also reported to survive in and Hinoba-an in southwestern Negros Oriental, though there is now very little forest remaining in this area.

The Philippine Spotted Deer Conservation Programme (PSDCP) was formally established in April in 1990 under the aupices of a new Memorandum of Agreement (MOA) between the Department of Environment and Natural Resources (DENR, Government of the Philippines) and the Parc Zoologique et Botanique de la Ville Mulhouse (Mulhouse Zoo, France), to enable development of a properly structured conservation breeding programme (viz: the ‘World Herd’ of captive R. alfredi) based on the accession of donated and confiscated individuals, previously illegally held as pets by private owners, and to initiate a variety of other related, highest conservation priority activities. These included: development of three local wildlife rescue and breeding centres (two on Negros, one on Panay); wide-ranging field surveys and other field studies; assistance in the establishment of new protected areas and related habitat restoration measures; distribution-wide public awareness campaigns; and diverse personnel training and other local capacity-building initiatives. This programme has since constituted easily the most successful programme of its kind in the Philippine but, and more importantly, it was also established and managed as a ‘flagship’ species/programme for the ‘West Visayas (or ‘Negros-Panay’) Faunal Region’; one of the world’s highest conservation priority areas in terms of both numbers of threatened endemic taxa and degrees of threat. As such the PSCDP has also constituted the principal driving force behind a diverse range of related conservation activities principally focused on a number of other most threatened West Visayan endemic species and species’ groups. As of 31 December 2006, there were also nearly 200 individuals of Negros Island origin and over 50 individuals of Panay Island origin in the captive breeding programme, and efforts are currently to conduct the first species reintroduction projects in the Philippines, and to do this by means of enabling the development of additional protected areas and/or the far more effective protection and restoration of selected existing protected areas (W. Oliver, 1996; Oliver et al, 2003, 2007)

Recommended conservation actions include:

1.Enhance management and protection of existing protected areas, most of which effectively ‘unmanaged’ and ‘unprotected’ at present owing any national budgetary resource allocations for these areas. One means of doing this would be to faciliate development of co-management agreements between the relevant national and local government agencies; thereby both actively involving the latter and enabling the allocation of annual local (provincial and municipal) budgetary appropriations for these purposes.

2. Establishment of new ‘local conservation areas’ (in effect ‘municipal reserves’) via the Philippine ‘Local Government Code’, and/or private nature reserves; either or both of which avoid the cumbersome processes of the “National Integrated Protected Areas System (NIPAS)’, which effectively transfers administrative authority for these areas to seriously under-resourced national government agencies, which are thus ill-equipped to development and implement effective protection and restoration measures.

3. Reinvestigate the current status of this species on Masbate and develop and implement relevant conservation management recommendations for the enhanced future protection of any remaining native forest habitats and the potential future reintroduction of this (and other West Visayan endemic species) on this island and on Cebu (where R. alfredi was extirpated in the mid-twentieth century), and in other selected ‘vacant’ habitats on Panay and Negros Islands.

4. Implement priority recommendations re. local awareness-raising arising from recent, range-wide ‘ethnobiological’ surveys, revealing both currently low levels of awareness re. local protection legislation and overwhelming prevalence of ‘recreational’ (rather than ‘subsistence’) hunting in all key sectors.

5. Monitor and control illegal captures and movement of spotted deer; assess status of privately-held captive stocks and continue attempts to access animals of known origin for a collaborative breeding program; develop and extend breeding program through dispersal of breeding stocks on loan to reputable (breeding loan signatory) institutions, which are also prepared to contribute resources and technical assistance for relevant in-situ conservation activities under the aegis of this “flagship” program. Extend these activities to other critically threatened Visayan endemic species and their habitats.

6. Conduct (or complete) systematic (including mtDNA) research on intra- and inter-population variation amongst surviving Negros and Panay Island populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The Visayan spotted deer is afforded some degree of protection through its occurrence in Mt. Camlaon National Park, North Negros Forest Reserve, Mount Talinis/Lake Balinsasayao Reserve and the proposed West Panay Mountains National Park (5). Although Visayan spotted deer are legally protected, their distribution in remote, dense, inland forest makes the practicalities of guard patrolling very difficult, and hunting therefore continues (3). In 1990, the Philippine Spotted Deer Conservation Program was set up to initiate a captive breeding programme and a number of other conservation measures, including a public education campaign and an annual series of conservation workshops (4) (5). Visayan spotted deer are currently held in captivity in Mari-it Conservation Centre in Panay, two breeding centres in Negros, and a dozen zoos in Europe (7). Despite the benefits of having a captive population to buffer against total extinction, the fate of the Visayan spotted deer in the wild remains highly uncertain, and current agricultural practices and hunting pressure must change if it has any chance of survival in its natural environment (3). Unfortunately, the poor state of the Philippine economy and political unrest make this an extremely difficult task, and captive-bred individuals will not be released into the wild until they have a fair chance of survival (3). The conservation of this rare and beautiful deer is therefore highly complex, and requires considerable efforts by the Philippine government to stabilise the economic environment before it has any real hope of recovery.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

It is hard to imagine how this species might affect humans negatively. The only possible negative effect would come from enforced protection of the habitat of this animal, which might preclude humans from moving thier subsistence agriculture to more fertile ground. However, there does not seem to be any enforcement of protection of the habitat of R. alfredi.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Visayan spotted deer are a source of food for the native people of the Visayan Islands. Even though it is illegal to kill this species, it doesn’t stop them, and it has a positive effect on their lives by providing food.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Visayan spotted deer

The Visayan spotted deer (Rusa alfredi), also known as the Philippine spotted deer, is a nocturnal and endangered species of deer located primarily in the rainforests of the Visayan islands of Panay and Negros though it once roamed other islands such as Cebu, Guimaras, Leyte, Masbate, and Samar. It is one of three endemic deer species in the Philippines, although it was not recognized as a separate species until 1983. An estimated 2,500 mature individuals survived worldwide as of 1996, according to the IUCN, although it is uncertain of how many of them still survive in the wild. The diet of the deer, which consists of a variety of different types of grasses, leaves, and buds within the forest, is the primary indicator of its habitat. Since 1991 the range of the species has severely decreased and is now almost co-extensive with that of the Visayan warty pig.

In April 2009 a team of British and Filipino scientists discovered evidence of two separate groups of deer in the North Negros Natural Park. These signs (scat and feeding sites) are believed to be the first scientific evidence of the deer's activity for over 25 years. It is estimated that an estimated 300 animals survive on the island of Negros. Conservation efforts are currently underway with the intention of preserving the remaining population of the species but are poorly funded and supported.

Appearance[edit]

Female specimen in captivity.
A young male.

The deer is small and short-legged yet it is the largest endemic species of deer among the Visayas. Adults range from 125 to 130 cm (49 to 51 in) long from the head to the base of the tail, 70 to 80 cm (28 to 31 in) in shoulder height and 25 to 80 kg (55 to 176 lb) in weight. This species is easily distinguished from other species of deer in the Philippines by the distinctive "A" pattern of beige spots which dot its deep brown back and sides. Other distinctive features include cream underparts and white fur on the chin and lower lip. The animal's head and neck are brown, but lighter than the body, and the eyes are ringed with paler fur. Males are larger than females and have short, thick, bumpy antlers.[3]

Behavior[edit]

Habitat[edit]

The species' range once covered the shoreline up to at least 2,000 m above sea level. Its habitat is in dense cogon grassland, and primary and secondary forest. Most of its habitat consists of areas where its diet of young shoots of cogon grass and young low-growing leaves and buds are plentiful. Besides areas that are dense in vegetation, it could also thrive in places it could graze. They may also visit burnt-out forest clearings for the floral ash. Due to the now restricted range of the deer, it is impossible to ascertain the preferred habitat of the species.[2]

Breeding[edit]

The deer breed from November to December, although mating could begin earlier. Males have a roaring call to attract females. Reports mostly mention a single calf with a mated pair, although conclusive evidence on the number of young is not available because of the rarity of sightings. Calves are born after a gestation period of around 240 days. Weaning takes place at six months and the calves are mature from 12 months.[3]

Conservation[edit]

This species is fully protected under Philippine law. Hunting and forest clearances as a result of logging activities and agricultural conversion are thought to be the causes of a devastating drop in the numbers of the deer (a 1991 survey found that the deer was present in only 5% of its former range). Despite this, the deer still exist in the more remote areas, specifically in the protected habitats of Mt. Canlaon National Park, North Negros Forest Reserve, Southern Candoni, and West Panay Mountains (a proposed National Park). In 1990, the Philippine Spotted Deer Conservation Program was set up to facilitate the conservation of the species. Some of the deer have been held in captivity in Mari-it Conservation Centre in Panay, two breeding centers in Negros, and in a number of European zoos.[3]

Since 1987, Silliman University Mammal Conservation Program, through the Center for Tropical Studies (CENTROP), has been engaged in the deer's captive breeding. The success of the program has led some of the captive-bred to be released in the interior forests of southern Negros, particularly in the interior of Basay, Negros Oriental.[4]

Threats[edit]

Deforestation has greatly contributed in the decline of the deer. Hunting, both by locals and sport hunters has also made an impact; subsistence hunting, sales of venison to local markets and speciality restaurants, and live trapping for the pet trade have all contributed to the species' dwindling numbers. Isolation and reduction of population is likely to have led to some herds becoming moribund. While cross-breeding with R. mariannus has been observed in captivity, the lack of a common range means this is unlikely to be a problem in the wild.[2]

Due to the severe pressures faced by the deer, the IUCN has twice listed it as an endangered species: firstly in 1994 (when it was de-listed within the year) and again in 1996 (which listing has continued until the present). The limited numbers of the animal in the wild (at least 300, down from almost 1,600) has led to the belief that prospects for its survival are bleak.[2]

Rediscovery[edit]

On April 2009, footprints and animal droppings belonging to the creature were found in the North Negros Natural Park by a scientific team of six British, five Filipinos, and one Irishman, who were studying the biodiversity of the park. The team, who were from Negros Interior Biodiversity Expedition, estimate that less 300 members of the species survive. The team discovered a set of footprints beside a river three days into the expedition. The distance between these footprints and a half-eaten set of young palm trees, which were found three days later, indicated that two groups of deer might be present in the nature preserve. Subsequently, the team found small piles of 20 to 30 pellets with a trail of deer footprints leading away. Because "other species such as the Visayan warty pigs and civet cats have distinctly different scat", the team were confident that the pellets belonged to the deer. This was the first evidence of a live wild population of the deer for more than ten years. The team was thrilled by their success, although one of the expedition leaders, Craig Turner, admitted "this discovery confirms [the deer] are surviving, but doesn't tell us they are thriving". Besides the deer, other species discovered were some unusual plants, including ground orchids and pitcher plants, and many bird and frog species. Specimens were sent to the cities of Bacolod and Dumaguete for further analysis.[5][6][7]

The animal was later featured in a front page story in the Philippine Daily Inquirer on May 24, 2009 in the story "The World's Rarest Deer Still Roam Negros". In the story, the British Ambassador declared the find "an exciting discovery". The expedition team is reportedly set to present their findings to the Royal Geographic Society.[4] Researchers involved in the expedition commented that "more protection" of the deer and similar endangered species in the park [is needed] "in order to assure their survival". They also said in the statement that "Philippine forests still harbor many rare and unique species, found nowhere else in the world".[8]

The expedition was sponsored by several environmental institutions and foundations, which are interested in promoting and protecting the biodiversity, present within the United Kingdom as well as in the Visayas in the Philippines, such as the Negros Forests and Ecological Foundation Inc., Silliman University, Coral Cay Conservation, and the Zoological Society of London.

In 2013, there were reports of sightings in the Southern Candoni region, indicating Silliman's releases in Basay have successfully expanded north.

References[edit]

  1. ^ Grubb, P. (16 November 2005). Wilson, D. E.; Reeder, D. M, eds. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 669. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b c d Oliver, W., MacKinnon, J., Heaney, L. & Lastica, E. (2008). Rusa alfredi. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 9 April 2009. Listed as Endangered (EN C2a(i))
  3. ^ a b c "Visayan spotted deer - Rusa alfredi - Information". ARKive. Retrieved 2009-07-29. 
  4. ^ a b "Spotting the spotted deer - Leonor Magtolis Briones". ABS-CBN News. Retrieved 2009-07-07. 
  5. ^ "Rare deer reveals signs of life". BBC Earth News. 2009-05-22. Retrieved 2009-07-07. 
  6. ^ Powell Ettinger (2009-07-22). "Wildlife Extra News - World’s rarest deer found alive and well on Philippine islands". Wildlifeextra.com. Retrieved 2009-07-29. 
  7. ^ "New plant, animal species found in Negros province - Regions - Official Website of GMA News and Public Affairs - Latest Philippine News". GMANews.TV. 2009-04-21. Retrieved 2009-07-29. 
  8. ^ "World’s rarest deer still roam Negros - INQUIRER.net, Philippine News for Filipinos". Newsinfo.inquirer.net. 2009-05-24. Retrieved 2009-07-29. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!