Overview

Brief Summary

Biology

This rarely seen deer, which is most active at dusk and dawn (3), is usually solitary and only occasionally travels in pairs (2). Moving about its territory, which males aggressively defend from others (3), the tufted deer searches for grasses and other vegetation on which to feed, with the white underside of the tail flashing into view with every bounce as it walks (2). If disturbed, the tufted deer may bark in alarm and will take flight, moving with nimble, cat-like jumps (2) (3). The mating season, or rut, takes place from September until December (5), when the loud barks of the tufted deer can be heard more frequently (2). After a gestation period of 210 days, a single young is born between May and July. The tufted deer reaches sexual maturity around the age of nine months (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The tufted deer is a fairly dainty deer, named after the tuft of long, blackish-brown hair growing from the forehead (2) (3). The antlers of male tufted deer are diminutive spikes, rarely protruding beyond the distinctive tuft of hair (3). Its body is a deep chocolate brown in colour on the upperparts, white below, with the coat composed of coarse, almost spine-like hairs, which give the tufted deer a somewhat shaggy appearance (2). The head and neck are grey, with white markings highlighting the tips of the ears (2). The underside of the tail is also white and can be seen as the deer holds its tail up as it runs (3). Both male and female tufted deer have large, stout upper canines (3), with those of the male forming tusks up to 2.5 centimetres long (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found in central and southern China and there are old records from northern Myanmar (Groves 2005, Smith and Xie 2008). There has been fairly extensive camera trapping in the Myanmar range of the species where it is known from old specimens, but these surveys have failed to locate the species (Than Zaw pers. comm.). If it does persist in Myanmar it must have an isolated habitat, or limited elevational or geographic range that has prevented its detection; the Wildlife Conservation Sociery surveys have looked for this species many times without any result (J.W. Duckworth pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Tufted deer live in northeast Burma (Myanmar) and southern and central China. Their range extends from 24 to 35 degrees N latitude and from 98 to 122 degrees E longitude.

(Sheng and Lu, 1982; Whitehead, 1972)

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The tufted deer occurs across southern and south-eastern China to eastern Tibet and into northern Myanmar (2) (5). E. c. cephalophus is the most westerly of the subspecies, ranging from north-eastern Myanmar into south-western China (5). E. c. ichangensis occurs in central-southern China and north-eastern Myanmar and E. c. michianus is restricted to coastal provinces of eastern China, while the distribution of E. c. fociensis is not clear (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Tufted deer are similar in appearance to muntjac, although they are slightly larger. They weigh from 17 to 50 kg (37-110 lbs), and are 110 to 160 cm long (3.6-5.3 ft), with a shoulder height of 50 to 70 cm (1.6-2.3 ft). The tail is 7 to 16 cm (2.8-6.4 inches) long. The coat is coarse and dark gray or brown, with a dark gray head and neck. The underside is white, including the underside of the tail, and the lips and the tips of their ears are also white. Tufted deer gets their name from the tuft of hair on the forehead, which can sometimes hide the small antlers of the male. These antlers are simple and spiked, growing from short bony pedicles. Tufted deer have no upper incisors, but their upper canines are long and tusklike, similar to those of the muntjac. Male tufted deer are slightly larger than females. When a tufted deer fawn is born, its coloration is similar to that of an adult tufted deer, but with two parallel rows of spots on the back, on either side of the spine. These spots fade and disappear when the young deer reaches maturity.

(Grzimek, 1990; Nowak, 1999; Waller, 2001; Whitehead, 1972)

Range mass: 17 to 50 kg.

Range length: 110 to 160 cm.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is known to live in high damp forests up to the tree line and close to water, between 300 and 800 m asl in southeastern China; between 1,500-2,600 m asl in the middle of its range; and to as high as 4,750 m asl in western Sichuan (Ohtaishi and Gao 1990). Its diet is grass, some browse, and fruits. They are secretive and crepuscular, and are usually solitary or found in pairs. They live within well-defined home territories where they travel along well-established paths, rendering them vulnerable to snares. Rut occurs between September and December, single or twin fawns are born in April to July after about six months gestation, and animals are sexually mature in about nine months (Sheng and Ohtaishi 1993). It lives on mountainous terrain covered by dense forests. It eats bamboo and herbs (Zhang et al. 2004). Zhang et al. (2004) also found that tufted deer habitats were characterized by relatively high shrub and herb density, but also a relatively high proportion of open land. Historically, this species was known from high damp forest in the northeastern Myanmar just below the snow line.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Tufted deer live in forested regions at high altitudes (between about 300 and 4600 meters above sea level), and in rain forests in high-altitude valleys. Their habitat is always near water.

(Nowak, 1999)

Range elevation: 300 to 4600 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

An inhabitant of mountainous forest, the tufted deer can be found between elevations of 300 and 4,750 metres (5), and is said to be always found near water (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Tufted deer eat leaves, twigs, fruits, grasses and other types of vegetation. They are both browsers and grazers. These deer tear off vegetation to eat by pressing the lower incisors against a callous pad that takes the place of upper incisors.

(Sheng and Lu, 1982; Waller, 2001)

Plant Foods: leaves; wood, bark, or stems; fruit

Primary Diet: herbivore (Folivore , Frugivore , Lignivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

The tufted deer is a terrestrial herbivorous grazer and browser and a source of meat to carnivores such as the leopard and dhole.

(Grzimek, 1990)

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Tufted deer bark when alarmed.

(Whitehead, 1972)

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Elaphodus cephalophus is prey of:
Panthera pardus
Cuon alpinus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

In captivity, tufted deer live to as long as 15 years, their longevity in the wild is not well documented.

(Waller, 2001)

Typical lifespan

Status: captivity:
15 (low) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22.7 years (captivity) Observations: One specimen was still living after at least 22.7 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

During the mating season, tufted deer males bark to attract mates. (Nowak, 1999)

Mating System: polygynous

Tufted deer mate in late fall and early winter, the young are born in the early summer after a gestation of 180 days. Tufted deer usually give birth to one or two fawns per year. (Sheng and Lu, 1982; Waller, 2001) Until the age of six months, a young deer is dependent on its mother. Tufted deer become sexually mature between eighteen months and two years of age. (Whitehead, 1972; Nowak, 1999)

Breeding season: Breeding occurs in late fall and early winter.

Range number of offspring: 1 to 2.

Average number of offspring: usually 1.

Average gestation period: 6 months.

Range age at sexual or reproductive maturity (female): 18 to 24 months.

Range age at sexual or reproductive maturity (male): 18 to 24 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average gestation period: 180 days.

Average number of offspring: 1.

Young tufted deer are nursed and cared for by their mother until independence. They are capable of standing soon after birth.

Parental Investment: precocial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Elaphodus cephalophus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1022-07|DQ873526|Elaphodus cephalophus| AACCGCTGATTATATTCAACTAATCACAAAGATATCGGTACCCTCTATTTACTATTTGGTGCCTGAGCAGGCATAGTAGGGACAGCTCTA---AGCCTATTGATTCGTGCTGAGCTAGGTCAACCTGGGACTCTACTCGGAGAC---GACCAAATTTATAACGTAATTGTAACTGCACATGCATTTGTAATAATTTTCTTCATGGTTATGCCTATTATAATTGGGGGATTTGGTAACTGACTAGTTCCCCTAATA---ATTGGTGCTCCTGACATAGCATTCCCTCGAATAAATAATATAAGCTTCTGACTTCTCCCACCCTCTTTTTTATTACTTTTAGCATCATCTATGGTTGAAGCTGGTGCAGGGACAGGCTGAACTGTATATCCCCCTCTAGCTGGCAACCTAGCCCATGCAGGAGCTTCAGTAGATCTA---ACCATTTTTTCTTTACATCTAGCAGGTGTCTCCTCAATTCTAGGGGCCATTAATTTTATTACAACAATTATTAATATAAAACCTCCTGCCATATCACAATATCAAACCCCCTTATTTGTGTGATCCGTACTAATTACTGCCGTACTATTACTCCTCTCACTCCCTGTACTAGCAGCG---GGAATTACAATACTATTAACAGATCGAAATTTAAATACAACCTTCTTTGACCCAGCAGGAGGCGGAGACCCCATCCTATATCAACACTTATTCTGATTTTTTGGTCACCCTGAAGTATATATTCTTATTTTACCCGGGTTTGGTATAATTTCTCATATTGTAACATACTACTCAGGAAAAAAA---GAACCATTTGGATATATGGGAATAGTCTGAGCTATAATATCAATTGGGTTCCTAGGATTTATTGTATGAGCCCATCACATATTCACAGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Elaphodus cephalophus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Harris, R.B.

Reviewer/s
Black, P.A. & Gonzalez, S. (Deer Red List Authority)

Justification
Listed as Near Threatened because this species is in probably significant decline (but most likely at a rate of less than 30% over three generation (approximately 21 years)) because it is being over-harvested, making the species close to qualifying for Vulnerable under criterion A2d.

History
  • 1996
    Data Deficient
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

As of 1993, there were estimated to be 500,000 tufted deer living in China. They are not listed as an endangered species, although deforestation for agriculture and logging threaten their habitat. There are several tufted deer living in zoos, and they have been successfully bred in captivity. Annual kill by humans is estimated to be about 100,000.

(Nowak, 1999; Sheng and Lu, 1982)

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Data Deficient (DD) on the IUCN Red List 2007 (1). Subspecies: Elaphodus cephalophus ichangensis (Ichang tufted deer), E. c. michianus (Michie's tufted deer), E. c. cephalophus, and E. c. fociensis are all classified as Data Deficient (DD) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No documented estimates of population size or trend are available, although Sheng et al. (1998) guessed that there might be 300,000 to 500,000 animals in China. Little work is being done on this species and its status is poorly known.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
In China, this species is hunted by locals (Ohtaishi and Gao 1990). Although data are lacking, given the very high level of harvesting of large mammals in China, it is reasonable to expect that this species in in decline. In Myanmar, hunting for trade to China is a pervasive threat that almost certainly applies to this species (J.W. Duckworth pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Very little is known about the status and threats of this elusive deer, other than it is hunted by local people (5), and a reported 100,000 individuals are killed each year (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is not listed by CITES. It is included in the Chinese Red List as Vulnerable A2bcd+3bcd (Smith and Xie 2008), but it is not classified as a national protected species. It is listed as a provincially protected species in Hunan, Sichuan, Tibet, and Gansu. Being a widespread species, it is likely to be present in many protected areas. There is a need to determine its current status in the wild across is its wide range in China. Activities should include field reconnaissance, population censuses, demographic surveys, ecological studies, and investigations into human use of the species. More effort is required to confirm the existence and status of the species in Myanmar, particularly in the north eastern part of Kachin State (J.W. Duckworth and Than Zaw pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The lack of information on the tufted deer means that the IUCN has been unable to assess its conservation status, and it is therefore classified as Data Deficient (1). To remedy this, further research has been recommend, including population censuses, surveys, ecological studies and investigations into human exploitation of this deer (5). Such knowledge will help inform future conservation measures should they be needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no adverse affects of tufted deer, they are too rare to pose a threat to crops.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Tufted deer may be hunted for meat and fur throughout their range. They may also help to alert humans to the presence of predators through their barks (Grzimek, 1990).

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Tufted deer

The Tufted Deer, Elaphodus cephalophus, is a small species of deer characterized by its prominent tuft of black hair on its forehead. It is a close relative of the muntjac, living somewhat further north over a wide area of central China and northeastern Myanmar. Although suffering from overhunting and habitat loss, this deer is not considered to be endangered. It is the only member of the genus Elaphodus. It is restricted to forested mountain habitat up to 4500 m above sea level, making study difficult.

Contents

Subspecies

Four subspecies of the tufted deer are recognized, with one having doubtful taxonomic status:[1]

  • E. c. cephalophus – the largest subspecies, brownish coat, found in southwestern China and northeastern Myanmar.
  • E. c. michianus – has a relatively narrow snout, found in southeastern China.
  • E. c. ichangensis – has a relatively broad snout and a greyish coat, found in Central China.[2]
  • E. c. forciensus – doubtful subspecies, distribution unclear.[1]

Description

Female tufted deer

The tufted deer is similar to a muntjac in appearance, but the longer necks and legs give it a slightly leaner appearance. The coat is coarse with short and stiff hairs, being almost black in the winter and chocolate brown in the summer. The lips, tip of the ears, and the underside of the tails are white. Perhaps the most striking feature of this deer is a tuft of horseshoe shaped hair on the forehead, being brown to black, and can be up to 17 centimetres (6.7 in) long. The white tail is used as a signal of alarm before escaping.[3]

The tufted deer is a small deer, but still larger than most muntjac species. It stands at 50–70 centimetres (20–28 in) at the shoulder, and the weight varies greatly from 17 to 50 kilograms (37 to 110 lb). The tail is short at around 10 cm (3.9 in). The antler is only present in males and is extremely short, almost hidden by its long tuft of hair.[2] Male deer also have long and sharp canines that protrude out of their mouths like fangs.

Habitat and distribution

Male tufted deer, with tusks and a more prominent tuft of hair. The antler is barely visible.

The tufted deer is found mainly in China, where it occurs in the south from eastern coast to eastern Tibet. It is absent from the extreme south of the country. There are old records of this species in northeastern Myanmar, but recent surveys failed to find any, possibly due to the lack of surveys on the preferred habitat.[1]

The tufted deer inhabits high, damp forests at 500–4,500 metres (1,600–14,800 ft) above sea level, close to the tree line. It is found in both evergreen and deciduous forests with extensive understory and nearby freshwater supply. The availability of salt licks is also a positive factor to the presence of this animal. This deer is able to withstand minor human disturbances, and is occasionally found in cultivated lands.[2]

Behavior and reproduction

The tufted deer is mainly solitary or found in pairs. It is crepuscular and travels in fixed routes about its territory, which is vigorously defended by the males. This is a timid animal and prefer places with good cover, where it is well camouflaged. It is easily disturbed and when alarmed it will let out a bark before running away in a wild pattern, displaying its white rump with every jump and flops down after, making it difficult for the enemy to follow.[4]

The mating season occurs between September and December, during which the loud barks males make could be easily heard. The gestation period lasts about 6 months and a litter of 1–2 is born in early summer. The young becomes sexually mature at the age of 1–2 years, and could live up to 10–12 years in the wild. The life span is much shorter in captivity, at about 7 years due to the frequent visits by humans makes this shy animal uncomfortable.[2][4]

Threats and conservation

Surveys from 1998 put the estimated population around 300,000–500,000 individuals, though a substantial, ongoing decline is almost certain. Overharvesting of large animals in China is a serious threat not only to this species. The hide of this deer is a fairly high-end texile material, especially after the vigorous conservation efforts made on other more endangered species. Habitat loss is also an issue in this rapidly developing country. In China, this species is listed as provincially protected species in many places, but it is not protected by the national law. It occurs in a number of protected areas. More study needs to be done on this poorly known species for efficient protection.[1]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!