Articles on this page are available in 2 other languages: Chinese (Simplified) (5), Dutch (1) (learn more)

Overview

Brief Summary

Roe deer live in woods, open fields and in the dunes. They eat all kinds of plants: grass, wild flowers, blackberries, buds and leaves from trees and bushes, mushrooms and all sorts of farm crops. They are found along the coast in the dunes of the mainland and on the islands Ameland, Terschelling, Sylt and Föhr. On Terschelling, they were released by well intentioned people. The animal ended up on Ameland by walking over the mud-flats from the Frisian coast, where there are many roe deer. The hunters on Ameland helped the population by releasing a few females on the island. Since 2002, hunting roe deer is prohibited in the Netherlands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Roe deer can be active throughout the 24-hour period, but the main peaks of activity occur at dawn and dusk (4). They are either solitary or occur in small mixed groups, and in winter large groups may form to feed together (4). They have a broad diet, which varies depending on the time of year, and includes the leaves of deciduous shrubs and trees (4), cereals, weeds (3), acorns, fungi, conifers and ferns (3). The breeding season or 'rut' occurs from mid-July to mid-August (2). During this time, males (bucks) become highly aggressive and defend their territories vigorously (2). Fights between males often ensue, two males lock antlers and push and twist (4); these fights can cause serious injuries and even death (2). The winning buck may then mate with a female; courtship involves the buck chasing the female (doe) for some time until she is ready to mate (2). Although mating occurs in August, the fertilised egg does not start to develop until the end of December or early January (3); the roe deer is the only hoofed animal to have this 'delayed implantation' (4), which is thought to be an adaptation to prevent births occurring during the harsh winter (2). Between 1 and 3 kids are produced in May and June (3), but twins are very common (4). The young are left alone during the day for the first 6 weeks of life; their spotted coats help to camouflage them (4), although mortality from predation can still be high (3). After this time they stay by their mother's side (4). Both sexes disperse, but females tend to stay closer to their mother's range than males (3). Sexual maturity is typically reached at around 14 months of age (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This small, elegant deer is reddish brown in colour during summer but becomes grey (4), pale brown or even black in winter (2). The tail is very small and there is a large white rump patch (4), which becomes less obvious or even absent during winter (1). Males are larger than females and have short antlers, usually with three points (4). The antlers are shed from October to January, and the new pair, which begins to grow immediately are covered in 'velvet', furred skin that supplies blood to the growing antlers (4). Young roe deer (called 'kids') have spotted coats (1) for the first 6 weeks of life (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The roe deer has a large range in the Palaearctic. It is found through most of Europe (with the exception of Ireland, Cyprus, Corsica, Sardinia, Sicily, and most of the smaller islands), including western Russia (Stubbe 1999). Outside Europe, it occurs in Turkey, northern Syria, northern Iraq, northern Iran, and the Caucasus (Wilson and Reeder 2005). It is extinct in Israel and Lebanon (Wilson and Reeder 2005) (though a re-introduction programme has started in Israel (M. Masseti pers. comm.)). It occurs from sea level up to 2,400 m asl in the Alps (von Lehmann and Sägesser 1986).

In southern Europe there are two subspecies with relatively restricted ranges. C. c. italicus occurs in central and southern Italy, between Southern Tuscany, Latium and Puglia, to Calabria (Lorenzini et al. 2002; Randi et al. 2004; Lorenzini and Lovari 2006). C. c. garganta occurs in southern Spain, in particular in Andalusia (Sierra de CÃ diz) (Lorenzini et al. 2002; Lorenzini and Lovari 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The roe deer is found throughout Europe and Asia Minor, except in the islands of Corsica and Sardinia, Lebanon, Isreal, Ireland and the eastern margin of eastern Europe. Their distribution was reduced and their range fragmented on account of hunting and other types of human interference between the late 19th and early 20th centuries. (Danilkin, 1996; Sempere et al., 1996; MSW Scientific Names)

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This species is native to Scotland but was reintroduced to the rest of the UK during the 19th century after it became extinct in the 18th century (3). Today the roe deer occurs throughout Scotland, and has a wide distribution in England with the exception of east Kent and the Midlands. In Wales they are fairly rare, and they are absent from Northern Ireland (3). This species also occurs throughout most of Europe (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Capreolus capreolus is classified as a telemetacarpalian. It is a small deer with a long neck minus a mane, relatively large ears (12-14 cm), a rudimentary tail (2-3 cm) and no preorbital glands. In the winter the coloration ranges from grayish-brown to dark brown. A large white caudal patch is present. In summer, they are reddish to red-brown. Males develop a thickened skin on their head, neck and anterior portion of the trunk. The caudal patch mentioned previously is either absent or less pronounced than in the winter. The top of the head is gray or brown and the metatarsal glands are brown or dark brown. Roe deer molt twice a year in spring and in autumn. The kids of this species are spotted.

Antlers are present and are shed annually in October and November. They regrow immediately afterwards. Males are slightly larger than females and have tuberculate, three tined antlers. The basal rosettes are well-defined.

Roe deer's hooves are narrow and short with lateral digits well-developed.

An analysis of 11 different populations gave a mean total length of 107-125.7 cm, shoulder height of 66-83.3 cm, body mass of 22.6-30 kg, maximum skull length of 191-212.2 mm and maximum skull width of 84.3-91.5 mm. The skull is small but somewhat elongated. Lacrimal bones are shorter than the orbital cavity diameter. The preorbital glands are rudimentary and the tympanic bullae are small. Anterior ends of the nasal bones are forked and touch admaxillary bones. Orbits are medium sized. The maxillary bone is comparatively high and is equal in length to the molar row. The dental formula is 0/3 0/1 3/3 3/3=32.

Range mass: 22 to 30 kg.

Range length: 107 to 126 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Average basal metabolic rate: 46.347 W.

  • Danilkin, A. 1996. Behavioural Ecology of Siberian and European Roe Deer. London: Chapman & Hall.
  • Prior, R. 1968. The Roe Deer of Cranborne Chase. London: Oxford University Press.
  • Sempere, A., V. Sokolov, A. Danilkin. 27 December, 1996. Capreolus capreolus. Pp. 1-7 in Mammalian Species. American Society of Mammalogists.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It occupies a wide variety of habitats, including deciduous, mixed or coniferous forests, moorland, pastures, arable land, and suburban areas with large gardens. It prefers landscapes with a mosaic of woodland and farmland (Stubbe 1999). Roe deer are well adapted to modern agricultural landscapes (Andersen et al. 1998, Danilkin 1996; Sempéré et al. 1996).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Roe deer prefer forest steppe and small insular forests among croplands. They also like high-grass meadows with some shrubs. They prefer burns and cutovers in forestlands and croplands that serve the purpose of revegetation. Human modifications, i.e. felling of trees and formation of croplands and meadows, as well as intensive agricultural methods, have historically been beneficial in regions with little snow. (Sempere et al., 1996)

Terrestrial Biomes: tundra ; savanna or grassland ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Typically occur in open, deciduous, mixed or coniferous woodlands (4). They also inhabit moorland, and suburbs with large gardens (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Roe deer consume apporximately 1,000 plant species in their range. Of these species, the percentage breakdown of plant type is as follows: 25% woody plants, 54% herbaceous dicotyledons and 16% monocotyledons. They may eat the needles of coniferous trees, but this usually only happens in winter when all other food sources are scarce. They are selective feeders, with a preference for energy-rich foods that are soft and contain large amounts of water. Due to their small stomach size and rapid digestion process, they require frequent food intake. They normally have between five and eleven separate feeding periods in a day. They may feed at hour intervals during periods of optimal food availability.

Plant types and individual species vary with the seasons and habit. However, one study has shown that variation in diet composition is more closely correlated with habitat than season. Forage reserves decline in the winter and their diet becomes less diverse. Consequently, metabolic rate and food consumption decrease. In the spring, metabolic rate, energy requirements and the process of digestion all increase. They prefer concentrated foods (seeds and fruits) in autumn. (Cornelius et al., 1999; Danilkin, 1996; Sempere et al., 1996)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / ectoparasite
adult of Lipoptena cervi ectoparasitises Capreolus capreolus
Other: major host/prey

Animal / dung saprobe
partly immersed perithecium of Podospora granulostriata is saprobic in/on dung or excretions of dung of Capreolus capreolus

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
15.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 17.5 years (captivity) Observations: Young females have an over 90% survival in the wild, though an increased mortality with age has been reported for both males and females after about 8 years of age (Loison et al. 1999). These animals may live up to 15 years in the wild (Bernhard Grzimek 1990). One wild born female was about 17.5 years when she died in captivity (Richard Weigl 2005). The implantation can be delayed from 2 to 5.5 months, so the total gestation time can last from 122 to 305 days.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males are sexually mature by the end of their first year. However, they are not likely to begin breeding until their third year of life. They are physiologically capable of reproduction from March to October, but the rutting season is largely restricted from June to August. Only in a few individuals does it occur earlier or later.

Breeding activity in females begins when they are 14 months old. They are monestrous, and the duration of estrus is typically 36 hours.

Roe deer are the only ungulate that has a latent period of pregnancy, and consequently their reproductive cycle differs from those of even closely related species. Implantation of the embryo usually occurs in January. The fertilized ovum at morula stage penetrates into the uterus where it divides. This is followed by a 4-5 month period with minimal miotic activity. Delayed implantation is not a function of photoperiod, as in weasels. It is controlled by the development of the blastocyst. The gestation period is between 264 and 318 days. Fawns are born between April and July. There are usually two fawns, possibly one or three. They weigh 1-1.7 kg, have their vision and are furred. They are practically helpless during the first few days of life and are easy victims to predators. The female nurses the fawns during the early months of life. During the first month, they are nursed five to nine times a day, two to four times in the second month and one to two in the months afterward. Lactation declines in August and stops completely in early autumn, but sometimes occurs through December. Fawns feed completely on vegetation at weaning. Their growth is rapid, and they double their birth mass at two weeks of age. By autumn 60-70% of the body mass of adult individuals has been attained. (Danilkin, 1996; Sempere et al., 1996)

Average gestation period: 10 months.

Average birth mass: 1010 g.

Average gestation period: 153 days.

Average number of offspring: 1.6.

Average age at sexual or reproductive maturity (male)

Sex: male:
655 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
413 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Capreolus capreolus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTCTCAACTAACCATAAAGATATCGGTACTCTATACTTGTTATTTGGTGCTTGAGCAGGCATAGTAGGAACAGCCCTAAGTCTATTAATCCGTGCTGAGCTAGGTCAACCTGGGACTCTACTAGGAGATGATCAAATTTATAACGTAATTGTAACCGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGTAATTGACTTGTCCCCTTAATAATTGGTGCCCCAGATATAGCATTCCCTCGGATAAATAATATAAGTTTCTGACTACTTCCCCCTTCTTTCTTATTACTCCTAGCATCATCTATAGTTGAAGCCGGAGCAGGAACAGGCTGAACCGTTTATCCCCCCTTGGCTGGTAATTTAGCTCACGCAGGAGCTTCAGTAGACTTAACTATTTTTTCTCTGCATTTAGCAGGTGTTTCTTCAATTCTAGGGGCTATTAATTTCATTACAACAATTATTAATATAAAACCTCCTGCTATATCACAATATCAAACCCCTTTATTTGTATGATCCGTATTAATTACTGCAGTATTACTACTTCTCTCACTTCCTGTCCTAGCAGCAGGGATCACAATACTGTTAACAGACCGAAACTTAAATACAACTTTCTTTGACCCAGCAGGAGGCGGAGACCCTATCCTGTACCAACACTTATTTTGATTTTTTGGTCACCCTGAGGTATATATCCTTATTTTACCTGGATTCGGTATAATTTCCCATATCGTAACCTACTACTCAGGAAAAAAAGAACCATTTGGGTATATAGGAATGGTTTGAGCTATAATATCAATTGGATTTTTAGGATTTATCGTGTGAGCTCACCACATATTTACAGTTGGCATAGATGTTGACACACGAGCCTATTTCACATCAGCTACCATAATTATTGCTATTCCAACCGGAGTAAAAGTTTTCAGTTGACTAGCAACGCTCCACGGAGGTAATATTAAATGATCACCCGCTATAATATGAGCCCTGGGTTTTATTTTCCTTTTTACAGTTGGAGGCTTAACTGGGATTGTTCTTGCTAATTCTTCTCTAGATATTGTTCTCCATGATACGTACTATGTCGTTGCACATTTCCACTATGTTCTATCAATAGGAGCCGTATTTGCTATTATGGGGGGATTTGTTCACTGATTTCCCCTATTCTCAGGCTATACCCTTAATAATACATGAGCCAAAATTCACTTTATAATTATATTTGTAGGTGTCAATATAACTTTCTTTCCACAACATTTTCTAGGACTTTCGGGTATACCACGACGATACTCTGATTACCCAGACGCATATACAATATGAAATACTATCTCATCTATAGGCTCATTTATCTCTTTAACAGCAGTCATACTGATAATTTTTATTATCTGAGAAGCATTTGCATCTAAACGAGAAGTCCTAACTGTAGAATTAACAACAACTAACCTAGAGTGACTAAATGGATGTCCCCCACCTTATCATACATTTGAAGAACCTACATACGTTAACTTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Capreolus capreolus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Lovari, S., Herrero, J., Conroy, J., Maran, T., Giannatos, G., Stübbe, M., Aulagnier, S., Jdeidi, T., Masseti, M, Nader, I., de Smet, K. & Cuzin, F.

Reviewer/s
Black, P.A. & Gonzalez, S. (Deer Red List Authority)

Contributor/s

Justification
A widespread and common species with no major threats. It is listed as Least Concern. However, subspecies C. c. italicus is rare (<10,000 mature individuals) and faces serious threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Attempts at conservation and more rational game management of the roe deer resulted in an increase in numbers, with their range being restored as well as extended. (Danilkin, 1996)

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

This common and widespread species is protected in the UK by the Deer Act 1991 (5). Certain methods of killing or capture are prohibited under Appendix IV of the Bern Convention (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is widespread and common, and is expanding in many areas. Having almost gone extinct in paerts of southern Europe because of habitat loss and over-harvesting in the first half of the last century, its numbers started increasing again 20-40 years ago because of countryside abandonment, improved hunting regimes and reintroductions. Densities in the northern and southern parts of the range tend to be lower than in the central parts of the range. The central European population is estimated to number c.15 million individuals. However, the endemic Italian subspecies C. c. italicus, which is largely restricted to southern Tuscany, probably numbers no more than 10,000 individuals and is at risk from hybridisation with introduced C. c. capreolus (Lorenzini et al. 2002), which has a large population in the Italian peninsula.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The main threat in Europe is the increased mixing of various genetic stocks as a result of translocations. This may be a particular threat to genetically distinct peripheral populations, such as those in northern Portugal, the southern Italian Apennines, and Greece (Randi et al. 2004, Lorenzini and Lovari 2006). Molecular studies show that roe deer in central and southern Europe are mainly admixed (Lorenzini et al. 2002, Randi et al. 2004), indicating that human manipulation has greatly affected the natural genetic structure of populations. The small remaining population of C. c. italicus is also threatened by poaching and predation by feral dogs (Lorenzini et al. 2002). The small remnant population in Syria is under severe threat from habitat reduction and human persecution (Masseti 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

As roe deer cause damage to forestry, horticulture and agriculture (4), they are managed as a pest (3). They are also exploited as a game species, and for meat; they are responsible for the greatest income for venison in Europe (3). Furthermore, road deaths are common (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed on the Bern Convention (Appendix III), and occurs in a large number of protected areas across its range. In general, this species can quickly re-build its numbers and may tolerate a relatively high hunting pressure, if in a suitable habitat and under an appropriate hunting regime. Management operations, such as re-introductions, restocking and translocations, have been carried out widely across its range, and should always be carried out using the appropriate genotypes.

To protect remnant populations of the Italian roe deer C. c. italicus, Lorenzini et al. (2002) recommended the following measures: (1) Conduct research to determine the genetic struture of Italian roe deer, (2) Map extant populations of Italian roe deer, with indications of their genetic purity, (3) Prohibit translocations of roe deer from northern stocks to central and southern Italy, and vice versa, (4) Facilitate the expansion of remaining populations by reducing poaching and eliminating feral dogs, and (5) Establish a re-introduction plan for southern Italy. Similar actions are recommended to protect genetically distinct peripheral populations in Portugal and Greece. In general, any translocations of roe deer should respect the genetic integrity of populations at the destination site.

Roe deer have been re-introduced into the wild in Israel in the Ramat Hanadiv park on Mount Carmel near Zichron Yaacov. The first release of six females and two males took place in February 1997, a second release of a male and a female took place in March 1998, and a third release of four animals was completed in 1999. Pending information on nthe success of this project, this re-introduction is not yet marked on the distribution map.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

There is no conservation action targeted at this widespread and common species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Roe deer are the most abundant wild ungulate species in Europe, and their populations in some countries are excessive. This can lead to negative interactions with humans, such as motor vehicle accidents. Game management is often necessary. (Sempere et al., 1996)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The roe deer is important as a game animal. The combination of this fact along with their widespread distribution and high levels of abundance make them a popular subject of scientific study. (Danilkin, 1996)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Roe deer

The European roe deer (Capreolus capreolus), also known as the western roe deer, chevreuil or just roe deer, is a Eurasian species of deer. It is relatively small, reddish and grey-brown, and well-adapted to cold environments. Roe deer are widespread in Europe, from the Mediterranean to Scandinavia, and from the British Isles to the Caucasus. It is distinct from the somewhat larger Siberian roe deer.

Distribution and related species[edit]

Stamp of Moldova 406.gif

The roe deer is distinct from the somewhat larger Siberian roe deer (Capreolus pygargus) that is found from the Ural Mountains to as far east as China and Siberia. The two species meet at the Caucasus Mountains, with the European species occupying the southern flank of the mountain ranges and adjacent Asia Minor and the Siberian species occupying the northern flank of the mountain ranges.

Within Europe, the European roe deer occurs in most areas, with the exception of northernmost Scandinavia (north of Narvik) and some of the islands, notably Iceland, Ireland, and the Mediterranean Sea islands; in the Mediterranean region it is largely confined to mountainous regions, and is absent or rare at low levels. Scottish roe deer were introduced to the Lissadell Estate in Co. Sligo in Ireland around 1870 by Sir Henry Gore-Booth, Bt.[3] The Lissadell deer were noted for their occasional abnormal antlers and survived in that general area for about 50 years before they died out and there are not believed to be any roe deer currently extant in Ireland.

In England and Wales roe have experienced a substantial expansion in their range in the latter half of the 20th century and continuing into this century. This increase in population also appears to be impacting woodland ecosystems.[4] At the start of the 20th century they were almost extinct in Southern England but since then have hugely expanded their range for no apparent reason and possibly in some cases with human help. In 1884 there was an introduction of roe from Württemberg in Germany into the Thetford Chase area and these spread to populate most of Norfolk, Suffolk and substantial parts of Cambridgeshire. In southern England they started their expansion in Sussex (possibly from enclosed stock in Petworth Park) and from there soon spread into Surrey, Berkshire, Wiltshire, Hampshire and Dorset, and for the first half of the 20th century most roe in southern England were to be found in these counties. By the end of the 20th century they had repopulated much of Southern England and had expanded into Somerset, Devon, Cornwall, Oxfordshire, Gloucestershire, Warwickshire, Lincolnshire, South Yorkshire and had even spread into mid-Wales from the Ludlow area where an isolated population had appeared. At the same time the surviving population in Scotland and the Lake District had pushed further down beyond Yorkshire and Lancashire and into Derbyshire and Humberside. Now roe can be found in most of rural England except for south east Kent and the greater part of Staffordshire and Cheshire although the expansion is continuing to the extent that before the end of this century anywhere in the UK mainland that is suitable for roe may have a population. Not being a species that need large areas of woodland to survive urban roe are now a feature of several cities, notably Glasgow and Bristol, where in particular they favour cemeteries. In Wales they are less common but have been seen as far south west as Cardigan and as far north west as Bangor and they are reasonably well established in Powys and Monmouthshire.

German colonial administrators introduced roe deer to the island of Pohnpei in Micronesia. They are hunted by locals in very steep and heavily vegetated terrain. The meat is openly sold in markets and restaurants in Kolonia, the capital city of Pohnpei and the Federated States of Micronesia.

Physical appearance[edit]

Roe deer in a grassland area.

The roe deer is a relatively small deer, with a body length of 95–135 cm (3.1–4.4 ft), a shoulder height of 65–75 cm (2.1–2.5 ft), and a weight of 15–35 kg (33–77 lb).[5] It has rather short, erect antlers and a reddish body with a grey face. Its hide is golden red in summer, darkening to brown or even black in winter, with lighter undersides and a white rump patch; the tail is very short (2–3 cm or 0.8–1.2 in), and barely visible. Only the males have antlers. The first and second set of antlers are unbranched and short (5–12 cm or 2.0–4.7 in), while older bucks in good conditions develop antlers up to 20–25 cm (8–10 in) long with two or three, rarely even four, points. When the male's antlers begin to regrow, they are covered in a thin layer of velvet-like fur which disappears later on after the hair's blood supply is lost. Males may speed up the process by rubbing their antlers on trees, so that their antlers are hard and stiff for the duels during the mating season. Unlike most cervids, roe deer begin regrowing antlers almost immediately after they are shed.

Habitat and diet[edit]

Roe deer tracks.

The roe deer is primarily crepuscular, very quick and graceful, lives in woods although it may venture into grasslands and sparse forests. They feed mainly on grass, leaves, berries and young shoots. They particularly like very young, tender grass with a high moisture content, i.e., grass that has received rain the day before. Roe deer will not generally venture into a field that has had or has livestock (sheep, cattle) in it because the livestock make the grass unclean. A pioneer species commonly associated with biotic communities at an early stage of succession, during the Neolithic period in Europe the roe deer was abundant, taking advantage of areas of forest or woodland cleared by Neolithic farmers.[6]

Roe deer of Eastern Europe, suit in April/May.
Roe deer fawn, two to three weeks old.

Behaviour and life cycle[edit]

The roe deer attains a maximum life span (in the wild) of ten years. When alarmed, it will bark a sound much like a dog and flash out its white rump patch. Rump patches differ between the sexes, with the white rump patches heart-shaped on females and kidney-shaped on males. Males may also bark or make a low grunting noise. Females (does)make a high pitched "pheep" whine to attract males during the rut (breeding season)in July and August. Initially it is the female who goes looking for a mate and it is common for her to lure the buck back into her territory before mating. The roe deer is territorial, and whilst the territories of a male and a female might overlap, other roe deer of the same sex are excluded unless they are the doe's offspring of that year.

Reproduction[edit]

The polygamous roe deer males clash over territory in early summer and mate in early fall. During courtship, when the males chase the females, they often flatten the underbrush leaving behind areas of the forest in the shape of a figure eight called 'roe rings'. Males may also use their antlers to shovel around fallen foliage and dirt as a way of attracting a mate. Roebucks enter rutting inappetence during the July and August breeding season. Females are monoestrous and after delayed implantation usually give birth the following June, after a ten-month gestation period, typically to two spotted fawns of opposite sexes. The fawns remain hidden in long grass from predators until they are ready to join the rest of the herd; they are suckled by their mother several times a day for around three months. Roe deer adults will often abandon their young if they sense or smell that an animal or human has been near it. Young female roe deer can begin to reproduce when they are around 16 months old.

In popular culture[edit]

  • The world-famous deer Bambi (the eponymous character of the books Bambi, A Life in the Woods, and its sequel Bambi's Children, by Felix Salten) is originally a roe deer. It was only when the story was adapted into the animated feature film Bambi, by the Walt Disney Studios, was Bambi changed to a white-tailed deer. This change was made owing to the white-tail being a more familiar species to the mainstream US viewers. Consequently, the setting was also changed to a North American wilderness.[citation needed]
  • A roe deer is also said to have helped Genevieve of Brabant to get food for herself and her child after having had to leave their home due to malicious slander.

See also[edit]

Notes[edit]

  1. ^ Lovari, S., Herrero, J., Conroy, J., Maran, T., Giannatos, G., Stübbe, M., Aulagnier, S., Jdeidi, T., Masseti, M, Nader, I., de Smet, K. & Cuzin, F. (2008). Capreolus capreolus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 10 April 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ Linnæus, Carl (1758). Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I (in Latin) (10 ed.). Holmiæ (Stockholm): Laurentius Salvius. p. 78. 
  3. ^ The roe deer by Henry Tegner 1951
  4. ^ Kinver, Mark (2013-01-01). "Roe deer numbers 'changing woodland ecosystems'". United Kingdom: BBC News Online. Retrieved 2013-01-02. 
  5. ^ Macdonald, D.W.; Barrett , P. (1993). Mammals of Europe. New Jersey: Princeton University Press. ISBN 0-691-09160-9. 
  6. ^ Boyle, K.V. (2006), "The Roe Deer: Conservation of a Native Species", in Serjeantson, D; Field, D, Neolithic wild game animals in Western Europe: The question of hunting, Oxford: Oxbow Books, pp. 10–23, ISBN 978-1-84217-214-8 

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!