Overview

Brief Summary

Biology

Marsh deer tend to live in pairs or small family groups of less than six individuals and are more widely distributed during the wet season when there is more suitable habitat available (2). Marsh deer remain hidden during the day and emerge at dusk and graze until early morning on a number of grasses and plants that are soft, protein rich and highly digestible (4) (5). Breeding generally occurs through the year, although further south, mating seems to take place between October and November. Gestation lasts for about eight months, with the females normally giving birth to a single fawn. The young are weaned at six months but remain with their mother for about a year. A female marsh deer is ready to mate again as soon as she has given birth and therefore may be pregnant throughout her breeding years (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This surprisingly shy and secretive deer is actually the largest native deer species in South America. Marsh deer have large, primarily ornamental antlers, which are usually impressively forked, growing to about 60 centimetres in length and weighing, on average, about two kilograms. They are shed irregularly and may be retained for up to two years. Marsh deer also have well-developed hindquarters, making them good at jumping, which is the fastest way to move in water (2). The marsh deer has a shaggy, reddish chestnut coloured coat, with paler undersides of the neck and belly. The muzzle and lips are black, as are the lower legs. The eye is surrounded by a faint white ring and the large ears are lined with white hair. Marsh deer have long, broad hooves that are particularly adapted to the marshy environment, as they are joined by a special membrane and can spread out, giving the hooves a greater surface area, to prevent the deer from sinking into swampy ground (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Marsh Deer, Blastocerus dichotomus, is the largest South American deer. Originally much more widely distributed throughout present range (Nowak and Paradiso 1983), it now occurs in east-central and northeastern Argentina, west-central and southern Brazil, Paraguay, southeastern Peru, and eastern Bolivia. The species has been extirpated from Uruguay.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The marsh deer occurs from savanna patches along the southern margins of Amazonian Peru and Brazil south through northeastern Argentina. While formerly known in Uruguay as well, it is probably now extinct there. The major distributional area is defined by the Paraguay and Parana river basins. Pleistocene fossil deposits indicate that the marsh deer once occurred through northeastern Brazil as well (Magalhães et al. 1992, Pinder and Grosse 1991, Redford and Eisenberg 1992, Whitehead 1972).

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Argentina, Uruguay, Paraguay, Bolivia, Brazil

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Extremely fragmented populations are found south of the Amazon River into northern Argentina, Brazil, Peru, Bolivia and Paraguay. It also used to occur in Uruguay, but is now believed to be extinct there (1). Recognised subpopulations are restricted to the Delta de Paraná in Argentina, the Iberá wetlands (Corrientes Province) in Argentina and the Paraná basin in Brazil (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Blastocerus dichotomus is the largest South American deer, recognizable in part by its large multitined antlers of eight to ten points when mature. Head-body length is usually just under two meters, with shoulder height from 1.0 to 1.2 meters. The pelage is reddish brown in the summer, turning a darker brown in the winter. The tail is reddish orange, bushy, and 10 to 15 cm in length. Marsh deer have large feet with an elastic membrane between the hooves, which may help to keep them from sinking in the mud of their preferred marshy habitat. The legs are black below the carpal/tarsal joints, and there is a black band on the muzzle. Marsh deer have white eye rings and borders of the ears (Mares et al. 1989, Pinder and Grosse 1991, Redford and Eisenberg 1992, Whitehead 1972).

Range mass: 89 to 125 kg.

Average mass: 109 kg.

Sexual Dimorphism: ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in the marshy habitats south of the Amazon River into northern Argentina (Pinder and Grosse 1991), with water depth as much as 0.0 m (Tomas et al. 1997). Diet is generally grasses, reeds and aquatic plants, but may include shrubs and vines during prolonged flooding (Nowak and Paradiso 1983). The marsh deer is generally solitary or found in small groups of 2–3. Aggregations of up to six animals have been reported on islands during floods (Schaller and Vasconcelos 1978). The marsh deer is the largest cervid species of South America. Male animals can reach up to 150 kg and the females up to 100 kg (Duarte and Merino 1997).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Marsh deer prefer marshy, swampy ground with standing water and dense vegetation. They also utilize flooded savannas during the wet season, but stay close to dense stands of reeds or similar vegetation near permanent water during the dry season. Surrounding mountainous terrain may also be favorable, but this may be an artifact of human hunting pressure as access is probably most difficult in mountainous areas (Mares et al. 1989, Whitehead 1972, Redford and Eisenberg 1992).

Terrestrial Biomes: savanna or grassland

Aquatic Biomes: rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Marsh deer are found in marshy habitats such as floodplains, grasslands and moist forests (4), preferring areas with a good amount of cover for protection, such as reed beds or where grass stands are high (2). This species is predominantly found close to permanent sources of water, favouring areas where the water level is about 50 centimetres, but do wade in areas where the water level reaches over a metre. When the water level gets too high the deer move to higher, dryer locations (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Marsh deer are herbivorous with diets comparable to other species of deer, although marsh deer consume mainly aquatic and riparian vegetation. Stomach analyses found that water lily and other leaves, grass, and browse were consumed. One study found that grass comprises about 50% of their diet and legumes 31% (Redford and Eisenberg 1992).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals, but one captive specimen lived 13.7 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Fawns are born singly, with mature coloration (no spots). Males do not shed their antlers at any particular time of the year, and may retain them almost two years. Rut usually occurs, however, in October and November, but the breeding season may not be fixed, and males do not seem to be particularly aggressive to each other. Newborn fawns are reported from May to September, as well as from September to November. The gestation period may be as long as a year (Whitehead 1972, Pinder 1996, Redford and Eisenberg 1992, Mares et al. 1989).

Average birth mass: 4200 g.

Average gestation period: 270 days.

Average number of offspring: 1.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Blastocerus dichotomus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTTTCAACTAATCATAAAGATATTGGCACCTTATATCTACTATTTGGTGCTTGAGCAGGCATAGTAGGAACTGCCTTAAGCCTACTAATCCGTGCTGAACTGGGCCAACCCGGAACTCTACTCGGAGATGATCAAATTTATAATGTAATTGTAACCGCACATGCATTTGTTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTCGGTAATTGACTTGTCCCCTTAATAATTGGTGCCCCAGATATAGCATTTCCCCGAATAAATAATATAAGCTTTTGACTTCTTCCTCCTTCCTTTTTACTGCTTCTAGCATCATCTATAGTTGAAGCCGGAGCAGGGACAGGTTGAACTGTTTATCCTCCCTTAGCTGGAAATCTAGCTCACGCAGGAGCCTCAGTCGACTTAACTATTTTTTCTTTACACTTAGCAGGTATCTCTTCAATTTTAGGGGCTATTAATTTTATTACAACAATTATTAATATAAAACCCCCTGCTATATCACAGTATCAAACTCCTCTATTTGTATGATCCGTACTAATTACTGCAGTACTACTGCTCCTTTCACTCCCCGTACTAGCAGCCGGAATTACAATACTACTGACAGACCGAAATCTAAATACAACCTTCTTTGATCCGGCAGGAGGCGGAGACCCTATTCTATATCAACACTTATTCTGATTTTTTGGACACCCTGAAGTATACATTCTTATCTTACCCGGATTCGGTATAATTTCTCATATCGTAACATATTATTCGGGAAAAAAAGAACCGTTTGGATATATGGGTATAGTCTGAGCTATAATATCAATTGGATTTTTAGGATTTATTGTATGAGCCCACCACATGTTTACAGTTGGGATAGACGTTGACACACGAGCCTATTTTACATCAGCTACTATAATTATTGCTATTCCAACCGGGGTAAAAGTATTTAGTTGATTAGCAACACTTCATGGAGGCAACATTAAATGGTCACCTGCTATAATATGAGCTCTAGGTTTTATTTTTCTTTTTACAGTTGGAGGATTAACTGGAATTGTTCTTGCCAATTCCTCTCTCGATATTGTTCTTCACGACACTTACTATGTAGTTGCACATTTCCACTATGTTTTATCAATAGGGGCTGTATTTGCTATTATAGGAGGATTCGTTCACTGATTTCCACTATTCTCAGGATATACCCTTAATGATACATGAGCTAAAATTCACTTTGTAATTATATTTGTAGGTGTAAACATAACCTTTTTTCCACAACATTTCCTAGGACTGTCTGGTATGCCACGGCGATATTCTGATTATCCAGACGCATATACAATGTGAAATACAATCTCTTCTATAGGCTCATTTATTTCCTTAACAGCAGTAATATTAATAATTTTTATTATCTGAGAAGCATTTGCATCCAAGCGAGAAGTCTCAACTGTAGAATTAACAACAACAAATTTAGAGTGACTAAACGGGTGCCCTCCACCATATCATACATTCGAAGAGCCTACATACATCAATTTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Blastocerus dichotomus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A4acde

Version
3.1

Year Assessed
2008

Assessor/s
Duarte, J.M.B., Varela, D., Piovezan, U., Beccaceci, M.D. & Garcia, J.E.

Reviewer/s
Black, P. & Gonzalez, S. (Deer Red List Authority)

Contributor/s

Justification
This species is considered to be Vulnerable due to an ongoing decline estimated from habitat loss in the past, and suspected habitat loss in the future based on direct and indirect threats. Based on rates of current decline, and considering a time period of three generations (15 years), including both past (10 years) and future (five years), this species is projected to have declined by more than 30%. Despite the lack of evidence of decline in the Pantanal population (Mourão et al. 2000, Rodrigues et al. 2005), the species may be considered to be declining throughout its geographic distribution. Although no data on demography are available for other populations, it is realistic to expect an overall decline due to poaching, habitat loss and disease. Habitat loss due to hydroelectric dams has been documented, but wetland drainage for agricultural purposes is also important in the floodplains of many rivers. Flooding by large reservoirs completely eliminates the best marsh deer habitats and isolates populations. Additionally, the retention of water by these dams causes deep changes in the flooding regime of wetlands downstream, which may cause disruption in the aquatic-plant communities, consequently reducing the carrying capacity of these habitats for Marsh Deer (Tomas et al. 1997, Tomas and Salis 2000). Drainage of the wetlands and its conversion into agricultural landscapes, also reduces its carrying capacity for the species. The main direct effects of habitat loss have been the fragmentation and isolation of marsh deer populations (Tomas et al. 1997), which may lead to demographic and genetic consequences. In Uruguay the species is thought to be extinct: the last record from this country was in 1958 (Ximenez et al. 1972).

History
  • 2002
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Vulnerable
    (Thornback and Jenkins 1982)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Marsh deer have suffered from uncontrolled hunting and habitat destruction, resulting in small, greatly-fragmented populations. Current hydraulic projects such as the proposed Hidrovia project on the Paraguay and Parana rivers threaten much of what remains of the habitat. One area, threatened with inundation in 1996 by a planned hydroelectric plant on the Parana River, contained 950 individuals making it the second largest population in Brazil. Marsh deer populations have also been reduced by cattle diseases, to which they are quite susceptible. Once common in Argentina, only a few hundred individuals may remain. Blastocerus dichotomus has been apparently extirpated in Uruguay (Mares et al. 1989, Pinder 1996, Quintana et al. 1992, Redford and Eisenberg 1992, Roig 1991, Whitehead 1972).

CITES: appendix i

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Blastocerus dichotomus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007 (1) and listed on Appendix I of CITES (3). The Paraná Brazilian Basin subpopulation is classified as Critically Endangered (CR), the Delta del Paraná subpopulation is classified as Endangered (EN) and the Iberá subpopulation is classified as Vulnerable (VU) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The species is declining throughout much of its range (Nowak and Paradiso 1983) although recent surveys in Brazil have revealed higher populations than had been previously recorded (Mauro 1995). Information gathered at a PHVA workshop indicates that approximately 41,000 Marsh Deer still survive in Brazil (Pinder 1995). In Argentina, population estimates are around 2,000 animals in Iberá marshes, other important populations are known from Formosa and the Paraná River Delta (Varela et al. 2001). In Bolivia, several populations are known from the Beni savannas and Noel Kempff National Park, and a recent population survey in Pampas Heath estimates 700 deer in the north of Madidi National Park (Gomez and Ríos-Uzeda 2004).

The principal population in Paraguay is in the Yacyretá region where density is low. Most populations in Paraguay were reported to be declining in the 1970s (Jungius 1974, 1976). In Peru the species occurred in small numbers in Pampas del Heath (Hofmann et al. 1976, Montanbault 2002, Escamilo pers. comm.). The last record of the species in Uruguay dates back to 1958 (Ximenez et al. 1972, González 1994).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species is declining throughout its range due to excessive hunting and wetland conversion for agriculture, tree plantations, and dams. In Brazil and Argentina, hydroelectric projects have eliminated floodplain habitat along many large rivers, including the Tiete, Paraná, and Rio Grande (DSG 1991), and cattle ranching has severely reduced and fragmented habitats. Competition with domestic livestock may be a major threat (Schaller and Vasconcelos 1978) and pollution of waterways associated with gold mining is a serious threat in the Pantanal. Accidental introduction of bovine diseases may account for large losses reported in Bolivia during the 1970s when reproductive failure was reportedly common (Mann and Schuerholz 1977). Beccaceci (1994) also mentioned disease, hunting, and competition with livestock as possible limiting factors in the Ibera Natural Reserve, Argentina. In the Paraná River Delta, the conversion of marshes for exotic tree plantation and hunting threaten the population in Argentina (Varela 2003). In Brazil, tick infestation was one of the most important causes of death after habitat loss in the Parana River basin (Szabo, et al. 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The marsh deer has disappeared from much of its former range as a result of hunting and the expansion of agriculture in central South America. From the early 19th century grasslands have been used to keep cattle on ranches with the exclusion of native deer (2) (4). Presently, the ongoing decline in marsh deer population numbers is predominantly due to habitat loss and fragmentation, caused by agriculture and the construction of hydroelectric dams destroying the floodplain habitat. Competition from domestic livestock also plays an important part, with more than 40 percent of the forest and savanna habitats in this region altered for cattle ranching through the introduction of exotic grasses (6). Marsh deer also suffer from poaching, pollution of waterways from gold mining and disease caught from domestic livestock (1) (7). The remaining populations of marsh deer are dangerously small and highly fragmented, and as a result, are more vulnerable to extinction.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is included on CITES Appendix I. The species occurs in several protected areas throughout its range. A management plan for this endangered deer is urgently needed to assure the survival of populations closely related with the major basin in South America (Mauro 1995). Recommended conservation actions include further population surveys, ecological research, strengthening of existing management of protected areas, creation of new protected areas, establishment of a collaborative captive breeding programme, and enlisting the co-operation of local landowners in maintaining this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Although there are protected areas within the range of the marsh deer, they are poorly managed. The Pantanal wetland is a Biosphere Reserve and is considered as a “wetland of international importance”; despite this only a tiny percentage is formally protected (6). A number of conservation proposals have been drafted and initiated including a reintroduction project in Río Pilcomayo National Park, Argentina in 1994, although the results of these are unknown (7). The World Conservation Union (IUCN) suggest future initiatives should include a review of the population status, the creation of new protected areas in suitable habitat and strengthening the management of existing protected areas, including measures to control hunting and exclude livestock (7). One potentially positive aspect for the survival of the marsh deer is that the private sector is increasingly establishing reserves in the area. Despite this, the future of the marsh deer is far from optimistic and a balance needs to be reached between conservation and human land use in the region (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

No negative impacts of B. dichotomus on human activities are reported in the literature. Wild ungulates sometimes compete with livestock for forage, and can serve as disease reservoirs, but the marsh deer's preference for wetland habitat may limit contact with some types of domestic livestock. Roxo and Gaspirini (1996) tested 116 marsh deer in Brazil and found that these deer do not harbor brucellosis in the São Paulo State region. Current numbers of deer are so low that negative impacts are very unlikely.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Marsh deer are valuable game animals, hunted for meat and sport (Roig 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Marsh deer

The marsh deer (Blastocerus dichotomus) is the largest deer species from South America reaching a length of 2 m (6.6 ft) and a height of 1.2 m (3.9 ft) at the rump. It is found in Argentina, Bolivia, Brazil, Uruguay and Paraguay. Formerly found through all of tropical South America today it is reduced to small isolated populations at marsh and lagoon zones in the basins of the rivers Paraná and Paraguay as in the Amazonian region of Peru where it is protected in Bahuaja-Sonehe National Park.

It is listed as a vulnerable species, according to CITES, appendix I.

Contents

Habitat

The Marsh Deer lives only in marsh areas, pantanal and chaco, usually with the water level reaching half a meter deep. They are swift swimmers. The marshes with their high vegetation density protect them from predators and provide them with food.

Description

They possess very large ears lined with white hairs, reddish brown colored body and long dark legs. The hair turns darker during winter. There are also white marks on the hips and around the eyes. The legs are black below the tarsal as is the muzzle. The tail is of a paler reddish tone than the rest of the body on its upper part and black on the under part. The head-and-body length is 153 to 200 cm (5.02 to 6.6 ft), while the tail adds a further 12–16 cm (4.7–6.3 in). The height at the shoulder can range from 100 to 127 cm (3.3 to 4.17 ft).[2]

The claw, which is large in relation to the body, has elastic interdigital membranes which are useful for swimming and walking on marshy surfaces. Only the males possess antlers which are ramified and reach a length of 60 cm (23 inches). An adult typically grows to a weight of 80 to 125 kg (180 to 280 lb), although an occasional big male can weigh up to 150 kg (330 lb).[3]

They are solitary animals or living in groups with less than 6 individuals with only an adult male. Their main predators are the jaguar and the puma.

Usually the rutting season coincides with summer but can change from animal to animal. Pregnancy lasts about 200 days. The offspring (normally one per female, though occasionally twins are born) are born between October and November. The infant deer are whitish which becomes more adult-like after a year.

Conservation

The natural predators of the Marsh Deer – the Jaguar (locally called onça or yaguaraté) (Panthera onca) and the Puma (Puma concolor)— have almost completely disappeared from its habitat. The former major threat was poaching for its antlers, but this is now under control. Destruction of its habitat presents nowadays the major threat to marsh deer. The dam at Yacyretá altered an area in which several hundred individuals lived and the draining of marshes for farmland and cattle threaten hundreds of hectares every year in Argentina and Brazil. Contagious diseases from cattle are also a problem, though it has been shown that the deer is not affected by brucellosis.

Gallery

References

  1. ^ Duarte, J.M.B., Varela, D., Piovezan, U., Beccaceci, M.D. & Garcia, J.E. (2008). Blastocerus dichotomus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 10 April 2009. Database entry includes a brief justification of why this species is of vulnerable.
  2. ^ [1] (2011).
  3. ^ [2] (2011).
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!