Overview

Brief Summary

Biology

Reeve's muntjac is active throughout the day and night, with peaks of activity at dawn and dusk (2). They feed on bramble, ferns, ivy, grasses and tree shoots, and unfortunately have a penchant for plants with a high conservation status such as bluebells and primulas (2), causing serious conflict in conservation areas (2). This deer is a solitary species; although individuals may occur in the same area (6). Unlike many deer species, Reeve's muntjac does not have a fixed breeding season, but reproduces throughout the year; correspondingly bucks are always territorial (6). They defend their territory by scent marking, depositing heaps of dung and aggressively repelling intruders using their canine teeth and/ or antlers (6). Females produce a single fawn at intervals of about 7 months (3), at 7 months of age, the fawns reach sexual maturity; females tend to remain close to their mothers' range, but males disperse further afield (3). This deer often barks for a number of reasons, which has earned the species the alternative common name of 'barking deer' (5). Both the Latin and common name refer to John Reeves, Assistant Inspector of Tea for the East India Company in 1812 (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

This small, stocky (2) introduced species has a shiny reddish coat which turns brownish-grey in winter, and the chin, throat, the area between the hind legs and underside of the long tail are paler (4). Both sexes have a rounded back, and large scent glands below the eye used for scent marking (6). Females are slightly smaller than males; other differences include males possessing antlers, which grow to 7cm in length, and obvious canine teeth that grow up to 3cm long (4). Furthermore, males have a dark 'V' pattern on the forehead (4), whereas females have a diamond shape (5). For the first 8 or so weeks of life, fawns have a light coloured coat with lines of spots around a dark stripe passing along the back (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species occurs widely in central and southern China and, and also on Taiwan. In China, this species ranges from coastal and south China to Jiangsu, Anhui, Henan, Shaanxi and Gansu (Smith and Xie 2008). Additionally, it occurs in eastern and central Sichuan, Guizhou, Yunnan, Guangxi, Guangdong, Fujian, Zheijiang, Jiangxi, Hunan and Hubei. The species has been introduced to England (where it is still present) and France (where it is no longer present) (Grubb, 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Muntiacus reevesi has a native range that extends throughout the subtropical forests of southeastern China and Taiwan. It has also become established in England after being introduced at Woburn, England (located in the middle of Bedfordshire county) around 1900. Feral populations may also exist in France, where introduced individuals escaped gardens and zoos.

Biogeographic Regions: palearctic (Introduced ); oriental (Native )

  • Chapman, N., S. Harris, A. Stanford. 1994. Reeves' Muntjac Muntiacus reevesi in Britain: their history, spread, habitat selection, and the role of human intervention in accelerating their dispersal. Mammal Review, Vol. 24, No. 3: 113-160.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Reeve's muntjac is native to China and Taiwan, and was introduced to the UK in 1894 to Woburn Park (3). Following escapes and deliberate movements, including a release from Whipsnade in 1921 (6), this species now has a wide distribution, which is concentrated in central England (3). There are also a few records from north Wales and northern England (3). Numbers are increasing rapidly at present (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Muntiacus reevesi has a chestnut-colored coat with a 4-inch tail that is black above and white below. It has been reported that the females tend to be slightly lighter in color than males, but these observations were mainly made on captive and feral M. reevesi in England and have not been corroborated with observations of M. reevesi in its native China. Chinese muntjacs stand 43 to 45 cm in height at the shoulder.

Sexual dimorphism in M. reevesi leads to larger, heavier males that have short antlers (125 to 150 mm) that grow from their pedicles and that have long, tusk-like canines (1 to 2 inches long). The canines are not entirely fixed to the premaxilla so they are less likely to be broken off during a fight. Both the male and female Chinese muntjacs have bony ridges on their faces that are lined with black hair along the inside. These ridges extend into hair-covered pedicles from which antlers (male) or black tufts of hair (females) project. Both the male and female Chinese muntjacs also have preorbital glands that produce a creamy liquid used for chemical communication.

As with all Muntiacus species, M. reevesi has only the upper parts of the 2nd and 5th digit metacarpals present, a physiology known as plesiometacarpalia. However, unlike other deer species that have 2 hooves of the same size and shape, M. reevesi has one hoof that is smaller than the other and that is lined with hairs that are visible in its footprints.

Range mass: 11 to 28 kg.

Average mass: 18 kg.

Range length: 700 to 1130 mm.

Average length: 800 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; ornamentation

  • Burrage, M. 2000. "Deer in the UK" (On-line). Muntjac Deer. Accessed February 07, 2004 at http://www.wilddeer.co.uk/muntjac-deer.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species occurs in temperate forests and in dense forests in the tropical and semi-tropical zone. In Taiwan, it occurs in mountains between 50-3,500 m asl in habitats ranging from tropical/subtropical lowlands to coniferous forests/alpine grassland at the highest altitudes. However, there is a decreasing trend in abundance with increasing altitude (Chiang 2007). In China, Reeve’s muntjacs occupy rocky places and open woodlands of pine and oak. They seek cover in steep ravines, and usually have well defined areas to which they retreat (Smith and Xie 2008). But in Taiwan, they were found mostly in forested areas (Pei and Chiang 2004), preferably in primary forest with dense canopy cover and tended to avoid steep terrain (Chiang 2007). They are basically solitary, although sometimes found in pairs or small family groups. Home ranges average about 100 ha, overlap considerably, and do not vary in size by gender. Females mature within first year. They appear to lack strong seasonality in reproduction (Hayssen et al. 1993, Smith and Xie 2008). Gestation is 209-220 days. In Taiwan, the species grow new antlers mostly in summer (peaking in June and July) (Pei and Liu 1994) (Pei and Chiang 2004) although velvet antlers were sporadically found throughout the year (Pei and Chiang 2004). In Taiwan, camera trapping data in remote areas with least human activities showed that Reeve’s muntjacs in Taiwan is crepuscular with significantly more diurnal than nocturnal activities (68% vs. 32%, Pei and Chiang 2004), which agreed with radio-telemetry results (McCullough et al. 2000). It is most active during the 2 hours after sunrise and before sunset and seasonal variations of activity levels were more pronounced in the afternoon (Pei and Chiang 2004).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Muntiacus reevesi is a forest creature in its native country of China. It creates paths through the subtropical rainforests at moderate elevations, which is why it has been termed by some as a bush hugger. It was observed that muntjacs in general tend to prefer habitats near streams, but evidence of this preference is not strongly demonstrated in the literature for this particular species of muntjac. Chinese muntjacs will fight to defend a fairly specific territory, but males have been shown to tolerate the presence of a subordinate male in their territory so long as that male is not in rut.

In England, M. reevesi exhibits slightly different preferences for habitat. It appears that the feral muntjacs of Britain are equally happy in habitats with and without cover; that is, muntjacs have been found in deciduous and coniferous forests as well as agricultural land, and even suburban and urban areas. In some respects, it is difficult to consider habitat preferences when a number of the metapopulations within the British population were specifically released into certain environments, so their presence in some habitats may not actually be an indication of a preference.

Reliable information on elevation preferences could not be found for the British population of M. reevesi, but in its native environment, it appears that M. reevesi prefers moderate elevations (moderate was not defined).

Habitat Regions: temperate ; tropical

Terrestrial Biomes: forest ; rainforest ; scrub forest

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

This secretive deer (5) inhabits dense scrub and woodland as well as quiet gardens (3). It is fairly versatile with regards to habitat, and this has helped it to colonise diverse areas, including Salisbury Plain, which consists of open grassland and scrub (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Muntiacus reevesi is surprisingly omnivorous. It eats bamboo, seeds, bark, fruit and foliage, as most other deer species, but it has also been found to eat eggs and carrion and is reported to be able to hunt small mammals and ground-nesting birds. It is reported to eat hunters' snared pheasants in China. In China, M. reevesi tends to be aggressively defensive of its territory because while food is available year-round, it is not plentiful.

Animal Foods: birds; mammals; eggs; carrion

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers

Other Foods: fungus

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

The alarm barks of Chinese muntjacs are excellent warnings for other small mammals that a predator, such as a tiger or leopard, is in the area. In China, the behavior and distribution of M. reevesi is interdependent with the behavior and distribution of other Cervinae species, especially M. crinifrons, M. muntjak and Elaphodus cephalophus. As the most generalized in its food habits of the muntjacs, M. reevesi has the widest range, preferring subtropical forest areas and tending to occur near water. The other Cervinae species have become distributed in either higher elevations, drier, open environments, or wetter, denser environments. These habitat types have led the other Cervinae to become more specialized in their diet and behavior than M. reevesi.

The impacts of muntjacs and other deer on plant diversity and woodland invertebrates in England have been studied and it appears that with natural deer populations, vegetation browsing may create more habitats for invertebrates and the presence of dung may allow for an increased diversity of invertebrates. This is contrasted with high-density deer populations, where deer will overbrowse an area and leave minimal plant diversity and reduce remaining plant quality for invertebrates. Similar impacts have been observed on small mammal populations, where muntjacs may act as direct competitors for resources or act as habitat modifiers. Just as with the invertebrate study, observations made about Chinese muntjacs’ impact on small mammals are density-dependent. Essentially, at high densities, the competition for resources and habitat modification through loss of cover will cause a decline in the populations of small mammals (such as Apodemus sylvaticus, Micromys minutus, Sorex anareus, Sorex minutus, Myodes glareolus, Apodemus flavicollis, Muscardinus avellanarius) that ripples through the food chain, especially affecting the predators of small mammals: Mustela nivalis, Mustela erminea and Vulpes vulpes.

Ecosystem Impact: creates habitat; keystone species

  • Flowerdew, J., S. Ellwood. 2001. Impacts of woodland deer on small mammal ecology. Forestry, Vol. 74, No. 3: 277-287.
  • Stewart, A. 2001. The impact of deer on lowland woodland invertebrates: a review of the evidence and priorities for future research. Forestry, Vol. 74, No. 3: 259-270.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Muntiacus reevesi is predated upon by a number of larger mammals and reptiles in southeast China. These natural enemies include leopards, tigers, dholes, jackals, crocodiles and pythons. In the introduced populations in England, the only potential predator is the fox. Behavioral differences may be noted between the English populations and those of China as the lack of predators leads M. reevesi to be much less vigilent in England and is therefore considered to be comfortable with the presence of man and human-altered surroundings.

When alarmed, Chinese muntjacs will bark for up to one hour. This distress call, however, does not appear to be meant to warn others but may simply be a vocalized expression of internal anxiety. This is mainly evidenced by the fact that muntjac barks tend to be emitted within a frequency range that would not carry through the dense vegetation that they inhabit.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / parasite / ectoparasite
Damalinia indica ectoparasitises Muntiacus reevesi

Foodplant / feeds on
Muntiacus reevesi feeds on Hyacinthoides non-scripta

Foodplant / feeds on
Muntiacus reevesi feeds on Mercurialis perennis

Foodplant / feeds on
Muntiacus reevesi feeds on Orchis mascula

Foodplant / feeds on
Muntiacus reevesi feeds on Dactylorhiza fuchsii

Foodplant / feeds on
Muntiacus reevesi feeds on Anemone nemorosa

Foodplant / feeds on
Muntiacus reevesi feeds on Cardamine pratensis

Foodplant / feeds on
Muntiacus reevesi feeds on Arum maculatum

Animal / parasite / ectoparasite / blood sucker
Solenopotes muntiacus sucks the blood of Muntiacus reevesi

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Muntiacus reevesi, as a member of the Muntiacus genus, is often known as a barking deer, yet the function of barking may be overestimated by casual observers. While it was originally thought that muntjacs used their barks to communicate with other muntjacs to communicate danger or location information, it appears that the barks of muntjacs have a more limited function than expected. Barks are primarily used in two circumstances; when predators are suspected in the environment and during social encounters when subordinate and dominant animals come into contact. The hypothesis that barks are used as a part of reproductive processes has not been substantiated. Likewise, expectations that barks were used to communicate danger to other muntjacs could not be corroborated in studies. The frequency of the barks of muntjacs prevents them from traveling any substantial distance, particularly in dense vegetation, so it is unlikely that barks evolved as a warning response. It has been hypothesized that the barking of muntjacs is actually a vocalization of inner anxiety that accompanies being hunted by predators or challenged by a dominant individual and that it has little to do with mating, defending territory, food procurement or identification of individuals. Evidence supporting this hypothesis is found in the observations of increased barking by the muntjac at dawn and dusk and in environments that have decreased visibility, such as very dense grassland environments.

Chinese muntjacs send signals to others about their identity, their territory and their sexual state using a combination of non-bark vocalizations and chemicals. The non-bark vocalizations that may be emitted by Muntiacus reevesi are used in reproductive situations where the male makes a buzzing sound and a female that is willing will make a cat-like whine. A main form of communication in M. reevesi comes through chemicals emitted by the preorbital gland. These chemicals are used as scent markers to define territories and to advertise presence of an individual. Studies have shown that the chemical composition of these secretions would permit muntjacs to identify an individual’s age, sex and population of origin, but the mere presence of these capabilities within the chemical does not mean that the muntjac are using chemical communication in that way.

Communication Channels: acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: acoustic

  • Boardman, S., D. Bourne. 2001. "Muntiacus reevesi Chinese muntjac" (On-line). Managing Foot and Mouth Disease. Accessed February 12, 2004 at http://212.187.155.84/pass_06june/Subdirectories_for_Search/SpeciesKingdoms/0Families_ACrM_Artiodactyla/Cervidae/Muntiacus/Muntiacus_reevesi/Muntiacus_reevesi.html#Sexual.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Little is known about the lifespan of M. reevesi in the wild. Anecdotal evidence would indicate that Chinese muntjacs, which are described as a duiker-like (for example, Cepalophus niger) organism due to its rapid development and its generalist tendencies, would probably have a similar life expectancy: 10 to 12 years. In England, with a lack of predators and abundant food sources, it may be expected that Chinese muntjacs may live even longer.

Range lifespan

Status: wild:
unknown (low) hours.

Range lifespan

Status: captivity:
18 (high) years.

Average lifespan

Status: wild:
10-12 years.

Average lifespan

Status: captivity:
23.2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23.2 years (captivity) Observations: In zoos, these animals can live up to 23.2 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Males gain access to females by defending territory that overlaps that of females. The males will fight with the tusk-like canines for access to females in estrous. The males do not use their antlers in offensive moves while fighting like the white-tailed deer Odocoileus virginianus, but they spar extensively while still young, and use the horns in defensive moves while fighting.

Mating System: polygynous

Muntiacus reevesi has year round breeding in its natural habitat in China. In England, Chinese muntjacs appear to have a more seasonal breeding cycle that occurs between late October and early March. Both sexes of M. reevesi develop rapidly so that they may reach their reproductive threshold weights (12 kg for bucks, 10 kg for does) within a few months of birth (36 weeks for bucks, 24 weeks for does). It is unlikely that very young males will be able to gain access to a doe in estrus, but younger males tend to be more reproductively successful than older males due to the quality of their canines.

Unlike other antlered deer, muntjacs use tusk-like canines to defend territory and gain access to females. When a doe in estrus is located, the male will make a buzzing sound and the female will respond by lying flat, weaving her head and emitting a cat-like whine that is a sign of submission. After copulation, male are no longer involved with the females and once the rut is over, males lose their antlers. Males may grow antlers in a period as rapid as 103 days, which is useful for a species that can breed year-round.

Breeding interval: The mean inter-birth interval is approximately 233 days.

Breeding season: Breeding can occur year round in the subtropics, but in England, the breeding tends to be somewhat seasonal, occuring between late October and early March.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 6.97 to 7.33 months.

Average gestation period: 7 months.

Average weaning age: 2 months.

Average time to independence: 6 months.

Range age at sexual or reproductive maturity (female): 24 (low) weeks.

Range age at sexual or reproductive maturity (male): 36 to 59 weeks.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; post-partum estrous

Average birth mass: 1050 g.

Average number of offspring: 1.

Parental investment is minimal in M. reevesi. The young develop extremely rapidly and are weaned early enough so that by the time that the caloric needs of the young really begin to escalate, they have begun to eat solid foods and are no longer dependent on their mother’s milk. Lactation generally occurs for only the first 17 weeks. Because the young become independent so early, there is no extra cost to a female to produce males (which would generally cost more in nutritional needs from a mother). By the age of 6 months, adulthood is reached and the young must leave the mother's territory.

Parental Investment: precocial ; pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

  • Lawson, R., R. Putnam, A. Fielding. 2001. Chemical communication in Eurasian deer (Cervidae): do individual odours also code for attributes?. Journal of Zoology, 253: 91-99.
  • Chapman, N., M. Furlong, S. Harris. 1997. Reproductive Strategies and the influence of date of birth on growth and sexual development of an aseasonally-breeding ungulate: Reeves' muntjac (Muntiacus reevesi). Journal of Zoology, Vol. 241: 551-570.
  • Pei, K., R. Taber, B. O'Gara, Y. Wang. 1995. Breeding cycle of the Formosan Reeves' muntjac (Muntiacus reevesi micrurus) in northern Taiwan, Republic of China. Mammalia, Vol. 59, No. 2: 223-228.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Muntiacus reevesi

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0581-06|NC_004069|Muntiacus reevesi| AACCGCTGATTATTTTCAACCAATCACAAAGACATCGGCACCTTGTACTTACTATTTGGTGCCTGAGCAGGCATAGTAGGAACAGCCCTA---AGCCTGTTAATTCGTGCTGAACTGGGTCAACCAGGGACCCTACTTGGGGAT---GACCAAATTTATAACGTAATTGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCCATCATAATTGGAGGATTCGGCAACTGACTAGTTCCTTTAATA---ATTGGTGCTCCAGACATAGCATTCCCTCGAATAAATAACATAAGCTTCTGGCTTCTCCCACCCTCTTTTCTACTACTTCTAGCATCATCTATAGTTGAAGCTGGCGCAGGAACAGGCTGAACCGTATATCCCCCTCTAGCTGGTAATCTAGCCCATGCAGGAGCTTCAGTAGATCTG---ACTATTTTTTCTTTACACTTAGCAGGTGTCTCTTCAATTTTAGGAGCCATTAACTTTATTACAACAATTATTAATATAAAACCCCCTGCCATATCACAATATCAAACCCCCCTGTTCGTGTGATCCGTACTAATTACTGCCGTACTTCTCCTTCTCTCACTTCCCGTACTAGCAGCC---GGAATTACAATACTACTAACAGACCGAAACTTAAACACAACCTTCTTTGACCCAGCAGGAGGTGGAGACCCTATTCTGTATCAACACCTATTCTGATTCTTTGGGCACCCTGAAGTATATATTCTTATTTTACCTGGGTTTGGGATAATTTCTCACATCGTAACATATTACTCAGGAAAAAAA---GAACCATTTGGGTATATGGGAATGGTCTGAGCCATAATATCAATTGGATTCTTAGGATTTATCGTATGAGCCCACCACATGTTCACAGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Muntiacus reevesi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Leasor, H., Chiang, P.J. & Pei, K.J-C.

Reviewer/s
Black, P.A. & Gonzalez, S. (Deer Red List Authority)

Justification
This species is considered Least Concern in view of its wide distribution, presumed large global population, occurrence in protected areas, and because its is not declining at a rate significant enough to qualify for a higher level of threat. However, this species is highly exploited in the industrial trade and there is significant habitat loss across many parts of its range. In addition, it should be noted that some of the reason for the relative lack of concern for this species may stem from its abundance in the UK rather than from its status in its native range in China and Taiwan.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Muntiacus reevesi is common in southeast China, therefore it is not listed as a threatened or endangered species. It appears not to have been studied by many conservation organizations, which most likely indicates that it is not a species of concern for those involved in protecting biodiversity.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Introduced to the UK (3). Under Schedule 9, Section 14 of the Wildlife and Countryside Act 1981, it is illegal to release into or grow this species in the wild (4). Listed under Appendix III of the Berne Convention (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In China, no population estimates or estimates of population trend are available. It is generally not considered to be highly threatened, although a recent China red listing categorizes the species as Vulnerable (Smith and Xie 2008). There is very little published information on the species in China. In Taiwan, where it is heavily exploited, the density was estimated at 9.3 animals/km² at elevations around, 2,000 m asl (McCullough et al. 2000); however, in areas without hunting and at lower elevations, the population density could be much higher (Chiang 2007).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The major threats to this species include habitat destruction and hunting. It is hunted for food and for hides which are used in the chamois market. Forest habitat is being lost in many parts of its range, in particular because of agriculture, logging and urbanisation. However, there is no information on the overall rate of decline of this very widespread species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Road deaths are common (3), and predation of fawns by foxes is a serious cause of mortality (3). Due to the problems this species causes, particularly in highly sensitive conservation areas, this species is controlled by shooting (3), although due to the year-round reproduction there is no close-season in which shooting is restricted (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species seems to be relatively secure in appropriate habitat, but its range is in an area where there is a high human population density and very heavy exploitation of wildlife. There is a need to monitor this species' habitat and population levels. In China, the species is not protected by national laws, but is protected under provincial regulations in Anhui, Henan, and Gansu. It presumably occurs in a number of protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

No conservation action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Muntiacus reevesi does not have any reported negative impacts in its native habitat because its populations are controlled by predator species and because it tends to live in forest environments. In England, however, M. reevesi, unchecked by predators, has become the most widely distributed deer and has been found to inhabit urban and suburban areas, as well as forests. They may be a nuisance to farmers and foresters due to their browsing on vegetation, particularly coppice.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Muntiacus reevesi has positive impacts for humans in both China and western European feral populations. In both environments, M. reevesi is hunted for meat (and in Britain, for sport). They have also been appreciated in their native environments for warning humans in the woods of the presence of a predator animal, such as a tiger or leopard, with their barks.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Reeves's Muntjac

Reeves' Muntjac (Muntiacus reevesi; Chinese: 山羌) is a muntjac species found widely in southeastern China (Gansu to Yunnan) and in Taiwan.[2] They have also been introduced in the Netherlands, the United Kingdom (south England,[3] the Midlands,[3] and east Wales[3]) and Ireland by 2008. It feeds on herbs, blossoms, succulent shoots, grasses and nuts, and was also reported to eat trees.[3] It takes its name from John Reeves, who was appointed Assistant Inspector of Tea for the British East India Company in 1812.

Contents

Description

This muntjac grows to 0.5 metres (1 ft 8 in) high at the shoulder,[4] 0.95 m (3 ft 1 in) in length, and weighs between 10 and 18 kilograms (22 and 40 lb) when fully grown. It is dog-like in appearance but has striped markings on its face.[4] The male has short antlers,[4] usually four inches or less, and uses them to push enemies off balance so he can wound them with his upper two inch canine teeth. The Taiwanese subspecies (M. r. micrurus), commonly known as the Formosan Reeves' Muntjac, is relatively dark compared to the other subspecies.

Reeves' Muntjac is also called the barking deer, known for its distinctive bark,[3] though this name is also used for the other species of muntjacs.

Muntiacus reevesi in the Zoo-Botanical Garden in Toruń (Poland)

Introduction into England

An unspecified species of muntjac was introduced to the grounds of Woburn Abbey in Bedfordshire in the nineteenth century by the then Duke of Bedford. While a small number are reported as escaping, it is extremely unlikely that they are the source of the current UK population. Larger numbers of muntjac escaped from Whipsnade Zoo, and they are the more likely ancestors, in addition to other releases.

Since the Wildlife and Countryside Act 1981, it has been illegal to release the species except where already established. Reeves' Muntjac colonies exist throughout England south of Derbyshire, and the population continues to grow. Small groupings of muntjacs have been seen in large urban parks in the Islington, Highgate, East Ham, Finchley and Greenwich areas of London, cemeteries, parks (seen in Green Park nr M4), and schools (Crosfields School) in the Reading area, the Headington Hill area outside of Oxford, Letchworth in Hertfordshire, Epping Forest in Essex, and in Warwickshire and Birmingham.[5] In Ireland, the first sightings of muntjac in 2008 caused the Government, concerned at the risk of the species becoming established, to quickly introduce an all year round hunting season.

Muntjac deer can be something of a traffic hazard, as they do not readily move out of the way of cars.[6][7]

Conservation

In Hong Kong, it is a protected species under Wild Animals Protection Ordinance Cap 170. Overall though it generally remains common and widespread, resulting in it being listed as Least Concern by the IUCN.[1] as there is an increasing number in the UK.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!