Overview

Distribution

Range Description

This species is occurs in China (formerly from Liaoning to Guangxi including the lower Yangtze Basin) and Korea; it has been introduced to England and France (Whitehead 1993).

The Chinese population was originally found in Jilin and Liaoning provinces in the northeast of the country, in the eastern Yangtze Basin and islands at the mouth of this river, and in the southeast of the country in northwestern Guangdong, southern Hunan and central and eastern Guangxi (Ohtaishi and Gao 1990). According to Hu et al. (2006) it is now restricted in China to the central portion of that distribution in the eastern Yangtze Basin, and populations in northeastern and southeastern China are now extinct.

Currently, the species' distribution in both Koreas may be substantially reduced, but little specific information is available. It is reported as being ?relatively widespread? in the Republic of Korea (N. Moores pers. comm., 2008), particularly along the west coast. It apparently remains relatively widespread in the lower-lying parts of DPR Korea, but assessing the true status is confounded by repeated reports of widespread and frequent releases of captive-bred stock. It is unclear at what levels these occurred in the past; since the mid-1990s they are likely to have been only at low, if any, levels in all except a few high profile areas. It is possible that Chinese stock have been included in the captive populations within DPR Korea, although this has not been confirmed (J.W. Duckworth in litt. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The Chinese water deer is found in the lower Yangtze Basin of east-central China and in Korea. The species was also introduced and became wild in England and France (Butzler, 1990; Allen, 1940).

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Chinese water deer are relatively small in size, ranging in length from 775-1,000 mm. They have a short tail, 60-75 mm length. The hair is generally thick and harsh. It is longest on the flanks and rump, with a maximium length of 40 mm in the winter coat. The top of the face is grayish and reddish brown, the chin and upper throat are whitish, and the back and sides are usually a uniform yellowish brown, finely striped with black. The underparts are white. Both sexes lack antlers, but the upper canine teeth, especially in the males, are enlarged, forming fairly long, slightly curved tusks. These saber-like upper canines are the most conspicuous feature of the bucks. Theyprotude up to about 52 mm from the upper jaw and constitute sharp, dangerous weapons. The canines of the female are much smaller, scarcely 5 mm on the inner side. A dark spot on the sides of the lower lip behind the upper canines makes the canines more conspicuous. A small scent gland is present on the face in front of the eyes on both sexes; this is the only known case of such glands in the Cervidae (Nowak, 1991; Butzler, 1990; Allen, 1940; Brown, 1991).

Range mass: 12 to 18.5 kg.

Average mass: 12.9 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Water deer are evidently an ?edge? species, preferring habitats characterized by shrubs and small trees (Rhim and Lee (2007). They prefer coastal plains, salt marshes, and riparian areas, and are negatively affected by human presence (Zhang et al. 2006a, b). It is unclear whether the species persists in Korea in purely agricultural areas away from the semi-natural riparian vegetation associated with large rivers and coastal plains (J.W. Duckworth in litt. 2008). However, further south in Korea, where unmodified waterways and patches of fallow habitat persist, water deer appear capable of living in rice-paddies (N. Moores pers. comm., 2008). As suggested by their name, water deer can swim (Guo and Zhang 2002), but appear unlikely to colonize areas > 20 km from a source population.

Other than during the mating season, it is in general a solitary species; stable pairs or small groups have been reported in places with high population densities. The rut, in England, starts in late November and extends through December and occasionally into January. From May to July, females will deliver litters of up to six fawns although the most common figure is only from one to three). Offspring mortality is high, with up to 40% of juveniles dying during their first four weeks.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Chinese water deer live among tall reeds, rushes along rivers, and in tall grass on mountains and cultivated fields. They also inhabit swampy regions and open grasslands. They are adept at hiding, and any cover seems sufficient to give them shelter. Although not adverse to water and swamps, they prefer drier land. When the the cultivated fields that they occupy are cut, they may be found lying in the furrows and hollows of open fields (Butzler, 1990; Allen, 1940; Wilson, 1993; Brown, 1991).

Terrestrial Biomes: savanna or grassland ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of the Chinese water deer includes reeds, coarse grasses, vegetables, and beets. The Chinese water deer has a four chambered stomach, but the rumen pillars are poorly developed. Because of this the deer cannot digest the carbohydrates from plant material very efficiently. Thus the deer must select foods low in fiber but high in soluble carbohydrates, proteins, and fats. Chinese water deer are highly selective feeders, taking herbs, forbs, and young sweet grasses, rather than the coarser and more fibrous vegetation of mature grasses (Nowak, 1991; Allen, 1940; MacDonald, 1987; Putnam, 1988).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Associations

In Great Britain and/or Ireland:
Animal / parasite / ectoparasite
adult of Lipoptena cervi ectoparasitises Hydropotes inermis

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
12.0 years.

Average lifespan

Status: captivity:
11.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 13.9 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The mating of the Chinese water deer is seasonal. In China mating occurs from November to January, and most young are born in late May and June. In the European zoos, mating usually occurs in May. Estimates of the gestation period range from about 170 to 210 days. Females are said sometimes to give birth to up to eight young at a time, more than are produced by any other kind of deer. In a survey of zoos, however, it was found that there were usually only two offspring per birth or occasionally three. After gestation, the female gives birth, often leaving her normal range and becoming solitary. The calf remains concealed for the first few weeks, emerging only when the mother visits to suckle it. Like many deer, the young animals have a camouflaged coat with light spots in parallel longitudinal lines. This pattern disappears with age. Lactation lasts several months, and thus the female deer are occupied with one or another aspect of reproduction for most of the year. In contrast, males contribute nothing to the rearing of their offspring. For a few weeks prior to the mating season the males compete for access to receptive females.

Males reach sexual maturity at 5-6 months, and females at 7-8 months. The lifespan of the Chinese water deer is about 10-12 years (Butzler, 1990; Allen, 1940; Nowak, 1991; Wilson, 1993; Ohtaish and Sheng, 1993; Brown, 1991; Putnam. 1988; MacDonald, 1987).

Range number of offspring: 6 (high) .

Range gestation period: 6 (low) months.

Average birth mass: 1042 g.

Average number of offspring: 2.7.

Average age at sexual or reproductive maturity (female)

Sex: female:
183 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hydropotes inermis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1896-09|EU315254|Hydropotes inermis| AACCGCTGATTATTTTCAACTAACCATAAAGATATTGGTACCCTATACTTATTATTTGGTGCCTGGGCAGGCATAGTAGGAACAGCCCTA---AGTCTATTAATCCGTGCCGAACTAGGCCAACCTGGAACTCTGCTAGGAGAT---GATCAAATTTATAATGTAATTGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGGGGTTTTGGTAATTGACTTGTTCCCCTAATA---ATTGGTGCTCCAGATATAGCATTTCCTCGGATAAATAATATAAGTTTCTGACTACTTCCTCCTTCTTTCTTATTACTCCTAGCATCATCTATAGTTGAAGCCGGAGCAGGAACAGGCTGAACCGTCTATCCACCCTTAGCTGGTAATTTAGCTCACGCAGGGGCTTCAGTAGACCTA---ACAATTTTTTCTCTACACTTAGCAGGTGTTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATAAAACCTCCTGCTATATCACAATATCAAACCCCTCTATTTGTGTGATCCGTATTAATTACTGCAGTACTATTACTTCTCTCACTCCCTGTTCTAGCAGCA---GGAATTACAATACTTTTAACAGACCGAAATTTAAATACTACTTTCTTTGATCCTGCAGGGGGCGGAGACCCTATCCTATATCAACACCTATTTTGATTTTTTGGCCATCCTGAAGTATATATTCTTATTTTACCTGGGTTTGGTATAATTTCTCATATCGTGACTTATTATTCAGGAAAAAAA---GAACCCTTTGGATATATAGGAATAGTTTGGGCTATAATATCAATTGGATTCTTAGGATTTATCGTGTGAGCTCATCATATGTTTACAGTTGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hydropotes inermis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cd

Version
3.1

Year Assessed
2008

Assessor/s
Harris, R.B. & Duckworth, J.W.

Reviewer/s
Black, P.A. & Gonzalez, S. (Deer Red List Authority)

Contributor/s
Moores, N.

Justification
Due to the lack of updated information it is not possible to assess the worldwide status of this species with complete certainty. However, a serious decline is nevertheless evident. Older sources seem to portray relatively healthy populations, in China (Ohtaishi and Gao 1990) and the Korean Peninsula (Won and Smith 1999). These are now decreasing due to poaching and habitat destruction. This species is not particularly adaptable and appears to be rather sensitive to environmental changes, which are ongoing and do not appear to be under control. Recent publications have suggested that the range for this species, especially in China continues to shrink. A decline rate of at least 30% over three generations (approximately 18 years) seems highly plausible.

History
  • 1996
    Lower Risk/near threatened
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Rare
    (IUCN 1990)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

In the wild, the Chinese water deer is heavily hunted. Although it is not classified as an endangered species, there recently were estimated to be only 10,000 individuals remaining in the wild in China (Butzler, 1990). IUCN -- Rare.

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Population densities have been said to be rather low in most places within its native range (Ohtaishi and Gao 1990, Won and Smith 1999, Hu et al. 2006), but few if any primary data have been presented in support of this. Signs (footprints, faeces) and sightings suggest high densities persist in semi-natural habitats of at least the lower (tidal) Chongchon plain of west-central DPR Korea (Pyongan North and Pyongang South provinces) in 2000?2004 although, as indicated above, some supplementation by released stock cannot be ruled out (J.W. Duckworth in litt. 2008). At another area holding the species in DPR Korea, Mount Kuwol (Hwanghae South province), signs were difficult to find in 1999 despite specific searches, although local farmers reported that significant numbers were still present. Repeated searches in the Myohyang mountains (Pyongan North, Pyongang South and Chagang provinces) in 1999?2004 found no evidence of the species but suitable habitat was marginal. Water deer are readily observed in the outskirts of Pyongyang but are presumably releases and/or the descendents of releases. Reasonable numbers are reported to persist elsewhere in the DPR Korea lowlands (Ju Jong Sil, Academy of Sciences, verbally 2003 to J.W. Duckworth).

Water deer occur in the Republic of Korea and it said to be ?moderately widespread?, particularly along the west coast, as well as within the demilitarized zone between the two Koreas (Kim and Cho 2005), but its population cannot be estimated.

Within China, Ohtaishi and Gao (1990) estimated fewer than 10,000 individuals in the lower reaches of the Yangtze River; 1,200-1,500 in coastal areas of Jiangsu; 600-800 in the Zhoushan Islands of Zhejiang; and 1,000 in the Poyang Lake (Jiangxi) region. More recently, Sheng (1998) estimated 500-1,1000 in the coastal areas of Jiangsu (see also Xu et al. 1998), 1,500 in the Zhoushan Islands, around 1,000 in the Poyong Lake region, and an additional ~ 500 individuals in Anhui.

Hu et al. (2006) present a map showing a considerable reduction in the current distribution of H. inermis compared with its known, historical range, and describe population declines of the species as ?drastic?. Their map suggests that the species no longer occurs in Jilin, Liaoning, Hebei, Shaanxi, Shandong, Henan, or Fujian provinces, and has become rarer in Hubei, Hunan, and Zhejiang provinces. However, the time period over which this range reduction is not known with any precision. Hu et al (2006) also provide data suggesting that H. inermis in the eastern-most (and densest) populations within China in Zhejiang and Jiangsu provinces retain a relatively high amount of genetic diversity, although populations on the Zhoushan archipelago displayed some divergence from those on the mainland. Within Yancheng Nature Reserve, their geographic distribution decreased and became markedly more fragmented between the 1980s and 2001 (Zhu et al. 2004).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Poaching and habitat destruction are major threats to this species (Won and Smith 1999). The species is valued for its meat, and for the semi-digested milk found in the rumen of unweaned fawns, which is used in traditional medicine as a cure against indigestion in children (Won and Smith 1999). It is sometimes trapped as a pest in China, and is reported to be a low-concern pest of rice fields in DPR Korea (J.W. Duckworth in litt. 2008). Hunting is carried out at night with dogs (Sun Lixing pers. comm. 1990). Most hunting in DPR Korea is probably with snares; guns are highly restricted and active hunting with dogs, although doubtless occurring to some extent, is too publicly visible to be the preferred choice. Snares for deer are at very high density in forest hill areas; no assessment has been made of their usage in the lower Chongchon plain where water deer remain common. It is not therefore possible to speculate on the species? resilience to such hunting (J.W. Duckworth in litt. 2008).

In Yancheng Nature Reserve, poaching is reported as severe, and there is high mortality during periods of flooding. Fawns have been bought from local people to establish and support the captive population, where the mortality rate is reportedly high (Zhang 1994). Water deer have evidently been reduced or extirpated in most of the reserve, remaining only in the relatively small core area (Xu et al. 1998, Zhu et al. 2004).

Habitat loss through reclamation for agriculture and urban development is a major threat to water deer in eastern China (Xu et al. 1998). Formerly widespread areas of appropriate habitat north of the Yangtze River delta have been lost and the remaining areas fragmented, leaving remaining populations of water deer vulnerable.

The Korean populations, at least in DPR Korea, are highly threatened by habitat loss, on the assumption that wild population will not persist in fully agricultural landscapes. It is reported, however, to be ?moderately widespread? at least in the Republic of Korea. In DPR Korea, agricultural policies have led to a large-scale land rezoning programme which involves the canalisation of streams, removal of damp hollows and generally the conversion to active farmland of all areas within the plains which have retained semi-natural vegetation to date. This programme is ongoing. Coastal habitats have so far fared better but there are ambitious plans for the reclamation of large proportions of the intertidal areas on the west coast, and this will involve major loss of the currently extensive suitable habitat present in natural coastal plains. With no empirical information on the use of purely agricultural regions by water deer in Korea, the precise effects of these ongoing and planned habitat changes are unclear; field study is required. Ground-dwelling mammals in DPR Korea are under heavy snaring pressure, at least in forest areas. The extent of snaring in the non-forest habitats occupied by this species and the effects of snaring on local populations are unclear. The situation in the lower Chongchon plain, an area with high human population densities and heavy conversion of plains land to agriculture (although retaining a largely natural coastal zone and channel profile for the river itself) suggest that either snaring levels are not so high in these areas or water deer are resilient to them (J.W. Duckworth in litt. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on the Chinese Red List as Vulnerable A2bcd, and is on China Key List II.

This species occurs in Poyang Lake Nature Reserve and Yancheng Nature Reserve, where around 1,000-1,500 animals are present in isolated subpopulations, each with less than 100 animals (Xu et al. 1998). However, nature reserve designation at Yancheng has evidently not prevented continued habitat loss and fragmentation (Zhu et al. 2004, Zhang et al. 2006a, b). Poyang Lake Nature Reserve has a management plan and is regularly patrolled. A small captive population has been established in Yancheng Nature Reserve, but the justification for this is unclear (Zhang 1994, Hu et al 2006)

Recommended conservation actions in China include:
1. Poyang Nature Reserve: Enlarge the reserve and improve its protection. The reserve covers only a small part of H. inermis? range in the Jiangxi region, and it is recommended that this be increased in size and that protection be extended to nocturnal patrols when the majority of poaching takes place.
2. Yancheng Nature Reserve: Establish habitat corridors to link small, isolated populations.
3. Strengthen existing protected areas management: increase staffing levels and improve communications and equipment supply; introduce anti-poaching patrols; develop community-based management strategies and an education program in response to human encroachment and poaching; and introduce training program for reserve staff in wildlife management techniques.
4. Create new protected areas (only a small proportion of the total population is currently protected).

In the Koreas, measures are needed to control poaching and to provide extensive areas of secure habitat for the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The Chinese water deer often comes into conflict with man when they eat his crops. They may also be pests of commercial forrestry (Putnam, 1988; MacDonald, 1987).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In the wild, the Chinese water deer is heavily hunted in order to obtain colostrum, which is sold for use in folk medicine. Colostrum, milk characterized by high protein and antibody content, is secreted for a few days after the deer gives birth. Also, thousands of Chinese water deer are sold as food each year in Europe (Allen, 1940; Webster, 1994).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Water deer

The Water Deer (Hydropotes inermis) is a small deer superficially more similar to a musk deer than a true deer (Cervidae - order Artiodactyla) but it is classified as a cervid despite having tusks (downward-pointing canine teeth) instead of antlers and other anatomical anomalies. These unique characteristics have caused it to be classified in its own genus (Hydropotes). Native to China and Korea, there are two subspecies: the Chinese Water Deer (Hydropotes inermis inermis) and the Korean Water Deer (Hydropotes inermis argyropus).

Contents

Habitat and distribution

Water deer are indigenous to the lower reaches of the Yangtze River, coastal Jiangsu province (Yancheng Coastal Wetlands), and islands of Zhejiang of east-central China, and in Korea, where the demilitarized zone has provided a protected habitat for a large number. They frequent the tall reeds, rushes along rivers, and in tall grass on mountains and cultivated fields as well as swampy regions and open grasslands. They have also been known to inhabit swamps, and when the cultivated fields that they occupied are cut, they may be found lying in the furrows and hollows of the open field.

A proficient swimmer, water deer can also swim several miles to make use of river islands.

Britain

Chinese Water Deer (Hydropotes inermis inermis) at the Whipsnade Zoo.

Chinese Water Deer were first introduced into Great Britain in the 1870s and were kept in the London Zoo. In 1896, they were transferred to Woburn Abbey, Bedfordshire, with further additions being imported and added to the stock. In 1929 and 1930, 32 deer were transferred from Woburn to Whipsnade, also in Bedfordshire, and released into the park. It is thought that the current Chinese Water Deer population at Whipsnade is over 600 whilst at Woburn it is probably in the region of 250 plus.

The present introduced population derives from a number of deliberate releases; the majority, however, is descended from escapees. The majority of the wild Chinese Water Deer population still resides close to Woburn Abbey. It appears that the deer’s strong preference for a particular habitat – tall reed and grass areas in rich alluvial deltas - has restricted its potential to colonize further afield. The main area of distribution is from Woburn, east into Cambridgeshire, Norfolk and Suffolk, and south towards Whipsnade. There have been small colonies reported in other areas.

The British Deer Society coordinated a survey of wild deer in the UK between 2005 and 2007 and noted Chinese Water Deer as "notably increasing its range" since the last census in 2000.[2]

France

There are currently small, highly localized feral populations.

United States

The species is not native, but a few small deer farms in the Southeastern United States have successfully bred water deer. Recently, the "vampire deer" have made headlines in Southern Tennessee because "Aimee," a small female, had escaped from a Marietta, Mississippi farm and displayed aggressive behavior towards visitors on the Natchez Trace Parkway.[3]

Physical attributes

Body LengthShoulder HeightTail LengthWeight
75–100 cm45–55 cm6-7.5 cm9–14 kg
2.5-3.3 ft18-22 in2.4-3 in20-31 lbs

The water deer has narrow pectoral and pelvic girdles, long legs, and a long, graceful neck. The powerful hind legs are longer than the front legs, so that the haunches are carried higher than the shoulders. They run with rabbit-like jumps. In the groin of each leg is an inguinal gland used for scent marking; this deer is the only member of the Cervidae to possess such glands. The short tail is no more than 5–10 cm / 1.9–3.8 in. in length and is almost invisible, except when it is held raised by the male during the rut. The ears are short and very rounded, and both sexes lack antlers.

The coat is an overall golden brown color, and may be interspersed with black hairs, while the undersides are white. The strongly tapered face is reddish brown or gray in color, and the chin and upper throat are cream colored. The hair is longest on the flanks and rump. In the fall, the summer coat is gradually replaced by a thicker, coarse-haired winter coat that varies from light brown to grayish brown. Neither the head nor the tail poles are well differentiated as in gregarious deer; consequently, this deer's coat is little differentiated.

Young are born dark brown with white stripes and spots along their upper torso.

Tusks

A stuffed specimen of H. inermis illustrating its tusks at the National Museum of Natural History in Washington, DC.

The water deer have developed long canine teeth which protrude from the upper jaw like the canines of musk deer. The canines are fairly large in the bucks, ranging in length from 5.5 cm / 2.1 in. on average to as long as 8 cm / 3.2 in. Does, in comparison, have tiny canines that are on an average of 0.5 cm / 0.2 in. in length.

The teeth usually erupt in the autumn of the deer’s first year at approximately 6–7 months of age. By early spring the recently-erupted tusks reach approximately 50% of their final length. As the tusks develop, the root remains open until the deer is about eighteen months to two years old. When fully grown, only about 60% of the tusk is visible below the gum.

These canines are held loosely in their sockets, with their movement controlled by facial muscles. The buck can draw them backwards out of the way when eating. In aggressive encounters, he thrusts his canines out and draws in his lower lip to pull his teeth closer together. He then presents an impressive two-pronged weapon to rival males.

It is due to these tusks that locals colloquially refer to this animal as a "vampire deer."

Behavior

Apart from during the rutting season, water deer are solitary animals, and males are highly territorial. Each buck marks out his territory with urine and faeces. Sometimes a small pit is dug and it is possible that in digging, the male releases scent from the interdigital glands on its feet. The male also scent-marks by holding a thin tree in his mouth behind the upper canines and rubbing his preorbital glands against it. Males may also bite off vegetation to delineate territorial boundaries.

Despite all findings of Goethean science water deer use their tusks for territorial fights and are not related to carnivores. Confrontations between males begin with the animals walking slowly and stiffly towards each other, before turning to walk in parallel 10–20 m / 32–64 ft. apart, to assess one another. At this point, one male may succeed in chasing off his rival, making clicking noises during the pursuit. However, if the conflict is not resolved at the early stage, the bucks will fight. Each would try to wound the other on the head, shoulders, or back, by stabbing or tearing with his upper canines. The fight is ended by the loser, who either lays his head and neck flat on the ground, or turns tail and is chased out of the territory. Numerous long scars and torn ears seen on males indicate that fighting is frequent. The fights are seldom fatal but may leave the loser considerably debilitated. Tufts of hair are most commonly found on the ground in November and December, showing that encounters are heavily concentrated around the rut.

Females do not seem to be territorial outside the breeding season and can be seen in small groups, although individual deer do not appear to be associated; they will disperse separately at any sign of danger. Females show aggression towards each other immediately before and after the birth of their young and will chase other females from their birth territories.

Communication

Water deer are capable of emitting a number of sounds. The main call is a bark, and this has more of a growl tone when compared with the sharper yap of a Muntjac. The bark is used as an alarm, and water deer will bark repeatedly at people and at each other for reasons unknown. If challenged during the rut, a buck will emit a clicking sound. It is uncertain how this unique sound is generated, although it is possibly by using its molar teeth. During the rut a buck following a doe will make a weak whistle or squeak. The does emit a soft pheep to call to their fawns, whilst an injured deer will emit a screaming wail.

Reproduction

Gestation PeriodYoung per BirthSexual MaturityLife Span
180–210 days1-7Does: 7–8 months10–12 years
Commonly 2-5Bucks: 5–6 months

During the annual rut in November and December, the male will seek out and follow females, giving soft squeaking contact calls and checking for signs of estrus by lowering his neck and rotating his head with ears flapping. Scent plays an important part in courtship, with both animals sniffing each other. Mating among water deer is polygynous, with most females being mated inside the buck's own territory. After repeated mountings, copulation is brief.

Water deer have been known to produce up to seven young, but two to three is normal for this species, the most prolific of all deer. The doe often gives birth to her spotted young in the open, but they are quickly taken to concealing vegetation, where they will remain most of the time for up to a month. During these first few weeks, fawns come out to play. Once driven from the natal territory in late summer, young deer sometimes continue to associate with each other, later separating to begin their solitary existence.

See also

References

  1. ^ Harris, R.B. & Duckworth, J.W. (2008). Hydropotes inermis. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 8 April 2009. Database entry includes a brief justification of why this species is of vulnerable.
  2. ^ "Deer Distribution Chinese Water Deer 2000—2007". bds.org.uk. http://www.bds.org.uk/c2/uploads/chinese%20water%20deer1.pdf. Retrieved 19 December 2010. 
  3. ^ Corinth Daily Ledger,"Strange Opener for Season?" November 2, 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!