Articles on this page are available in 1 other language: Chinese (Simplified) (5) (learn more)

Overview

Brief Summary

Biology

Since this deer is so rare in the wild, the only observations of its behaviour come from captive populations (5). This species is social and lives in large herds, except before and after the breeding season, or 'rut', in June. At these times males leave the herd to feed intensively and build up strength, and before the rut, females bunch together in several groups (6). A stag joins each group of females and engages in fights with rival males using its antlers, teeth and forelegs (2). The successful stags win dominance and, as the fittest males, are able to mate with the females. During the rutting season males do not feed, as every moment is spent trying to establish dominance over other males. Therefore, after leaving the females, males will begin feeding again and quickly regain weight. After a gestation period of 288 days, females give birth to one or two fawns (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Almost driven to extinction, this deer now only survives in captivity (1) (3). Pere David's deer is named after Father ('Pere' in French) David, who observed the last remaining Chinese herd and inspired a drive to bring them back from the brink of extinction (4). The Chinese people call this mammal 'sze pu shiang' which translates as 'none of the four'. This strange name refers to the deer's appearance as it looks like it has the neck of a camel, hooves of a cow, the tail of a donkey, and antlers of a deer (5). Indeed it does have a donkey-like tail which ends in a black tuft, and the 'neck of a camel' description refers to the long slender neck of this deer. The head is also unusually long and slender, with small pointed ears and large eyes (5). Adult males (stags) do bear antlers and, unusually, there may be two pairs of antlers per year. The summer antlers are the larger set, and are dropped in November following the rutting season. The second set then appear in January and are lost a few weeks later. Unique among deer, this species has antlers with a main branched anterior segment, with the points extending backwards (2). This deer's summer coat is reddish tan in colour and becomes woollier and dark grey in the winter. The underside is a cream colour and along the spine there is also a distinctive darker stripe. Juveniles are spotted with pale flecks (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is endemic to China. Père David’s deer has been recovered from the brink of extinction and has become a classic example of how to rescue a highly threatened species (Ebenehard 1995). In the mid 1980s, Père David’s deer was re-introduced into captive facilities in China, and populations established in Beijing, Dafeng, Tianezhou and Yuanyang.

Fossils of Elaphurus bifurcates, E. chinanensis chia, E. lantianensis have been excavated from the region east of Xi’an and south of Harbin. The modern species of Elaphurus, Père David’s deer (Milu in Chinese) evolved in the Pliocene period of the Tertiary, according to fossils excavated in southern Japan. During the Pleistocene period, it was known from Manchuria (Hofmann, 2007). During the Holocene, P. davidianus was restricted to swamps and wetlands in the region south of 43°N and east of 110°E in mainland China (Cao 1992, Zhou, 2007). However, the distribution of P. davidianus shrank and its population declined due to hunting and land reclamation in the swamp areas as human population expanded (Jiang and Li, 1999). P. davidianus had largely disappeared in the wild by the late 19th century, and the last wild animal was shot near the Yellow Sea in 1939.

However, during the Qing Dynasty (1616-1911), the Nanyuang Royal Hunting Garden contained a herd of P. davidianus in its 200 km² hunting ground. This hunting garden in the southern suburbs of Beijing was predominantly a wetland, consisting of swamps, ponds and lakes crossed by the Yongding River. The area had been sealed off from the outside world since the Yuan Dynasty (1205-1368) as a royal garden. The French missionary Père Armand David “discovered” P. davidianus in the Nanyuan Royal Hunting Garden in 1864. Realising that the deer was an unknown species to the West, he persuaded the wardens to give him hinds and skeletons of an adult male, an adult female and a young male, and sent them to Paris in 1866, where the species was named Père David’s deer by Milne-Edwards. In 1895, the wall of the Nanyuan Hunting Garden was destroyed by a heavy flood of the Yongding River, and most of the Père David’s deer escaped and were hunted. Only 20-30 animals survived in the garden. Then in 1900, during the Boxer Rebellion, the garden was occupied by troops and the remaining deer were shot and eaten.

However, before the demise of the royal herd of Père David’s deer in the Nanyuan Royal Hunting Garden in 1900, the deer had been introduced into private deer collections in the United Kingdom, France and Germany. During the first decade of the 20th century, the 11th Duke of Bedford in the United Kingdom gathered the last 18 Père David’s deer in the world to form a breeding herd at the Woburn Abbey, England. Only 11 of these deer were capable of reproducing (Bedford, 1951-52). Nevertheless, the heavily inbred Père David’s deer safely passed though the genetic bottleneck of inbreeding and adopted the vast open parkland of an English country estate (Jones et al. 1983).

The captive population started to increase (though with a setback during the First World War due to food shortage), and since the Second World War, the animals started to be spread through captive facilities worldwide, with the first captive animals being sent back to Beijing Zoo in 1956. More recently deer have been sent to China into managed, fenced situation in Beijing, Dafeng, Tianezhou and Yuanyang.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The historic range of E. davidianus was northeastern and east-central China (Nowak, 1999). Truly wild specimens disappeared from the area sometime around 200 A.D., but because a captive herd was maintaind in the Imperial Hunting Park, the species has survived.

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The Pere David's deer occurs in China, in the 1,000 hectare Dafeng Nature Reserve, where it was reintroduced (from a European captive population) after China's wild population became extinct over 1,000 years ago (3). There are also internationally held stocks (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

E. davidianus has reddish to deep reddish brown summer pelage with a medial black stripe down the shoulders. Winter pelage is grayish brown with darker areas on flanks and throat. Both sexes have a dark tail tassel on their relatively long tail. The skin between the hooves is naked (Nowak ,1999).

Pere David's deer range from 1,830 to 2,160 mm from head to the base of the tail. The tail adds another 220-355 mm. Male E. davidianus weigh about 214 kg and females about 159 kg. Males have antlers that are shed annually in December or January (Nowak, 1999). New antlers immediately begin growing and reach full size by May (Huffman, 2001). Antlers are around 55-80 cm along the curve and fork close to the skin (Harper, 1945). The long hind prong is very straight, and the front prong branches off with the prongs facing backwards. Males also have a maned throat (Nowak,1999).

Immature E. davidianus are spotted white with an average birth weight of about 11 kg (Nowak ,1999).

Range length: 1,830 to 2,160 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Average mass: 186500 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Studies have been carried out on the behavior, ecology and reproduction of Père David’s deer in Beijing since 1985, in Dafeng since 1986, and in Tianezhou since 2001. This species lives in low-lying grasslands and reed beds, often in seasonally flooded areas such as the lower Yangtze River valley and coastal marshes. It eats grass, reeds and leaves of bushes, can swim well, and spend long periods in water. It lives in single sex ormaternal herds. Animals reach maturity during second year. Gestation is 270-300 days. One, rarely two young are born. These are weaned in 10-11 months. Adults live up to 18 years. Data from the Dafeng Reserve suggests that female E. davidianus establish a home range of approximately 1 km² (Hu and Jiang 2002).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historically, E. davidianus were probably found in the lowlands of China, swampy areas and reed-covered marshlands (Nowak, 1999). Today they survive in the wild in two national parks: Beijing Milu Park and the Dafeng Milu Natural Reserve. This species can also be found in captivity in many zoos around the world.

Habitat Regions: temperate

Wetlands: marsh ; swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species' original habitat is thought to have been swampy, reed covered marshlands. The Dafeng Nature Reserve, where it now occurs, is a seasonally flooded coastal marsh site (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

E. davidianus are herbivores and their diet consists mainly of grasses. During summer they will eat many aquatic plants (Nowak, 1999).

Plant Foods: leaves

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

It is difficult to assess the ecosystem role of such a rare animal. Historically, at least, these deer were probably important in maintaining habitats through their foraging behavior. They probably also provided food to predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Because there are no real wild populations of this species, information on predation is not available.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Development

See Reproduction.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The maximum longevity record is 23 years and 3 months. Average life span is about 18 years (Huffman, 2001).

Range lifespan

Status: captivity:
23 (high) years.

Average lifespan

Status: captivity:
18 years.

Average lifespan

Status: wild:
18.0 years.

Average lifespan

Status: wild:
23.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 27.5 years (captivity) Observations: In the wild, these animals have been estimated to live up to 18 years (Bernhard Grzimek 1990). One captive specimen lived 27.5 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males engage in mock combat and real fights during the rut. A male joins a group of females which he thus defends from other males. Stags lose weight rapidly because they don't eat while they defend the harem, and they are succeeded by new stags as the rut continues. After leaving the harem, the male begins to feed again, and will quickly regain his weight.

Mating System: polygynous

Sexual maturity for females is about 2 years and 3 months (Nowak, 1999), and males mature about a year later. About two months before breeding season in June, males will leave the herd. They will rejoin a harem of females and fast during the rut. When fighting, males will use antlers, teeth, and will even rise up on hind legs and box with their front legs. Females have an approximately 20 day long estrous cycle (Nowak, 1999), and within a breeding season can have multiple cycles. The gestation period is about 280 days and one or two fawns are born in April or May (Jiang et al., 2001). Fawns weigh about 11 kg at birth. After the rut, males will leave the herd again for another two months and begin feeding (Brinklow,1993).

Development in species has not been reported. The gestation period is unusually long, however, and an embryonic diapause may occur (Nowak, 1999).

Breeding season: Young are born in April and May.

Average number of offspring: 1-2.

Average gestation period: 9.33 months.

Average age at sexual or reproductive maturity (female): 27 months.

Average age at sexual or reproductive maturity (male): 27 months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 11000 g.

Average gestation period: 288 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1186 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
821 days.

As in all mammals, the female provides the young with milk.

Parental Investment: female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Elaphurus davidianus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAACCGCTGATTATTTTCAACTAACCACAAAGATATCGGTACTCTATATCTATTATTTGGTGCCTGAGCAGGCATAGTCGGAACAGCCTTAAGCCTACTGATTCGTGCTGAATTAGGTCAACCCGGTACTCTGCTTGGAGATGACCAAATTTATAATGTTATCGTAACCGCACACGCATTCGTAATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGACTAGTTCCCCTAATAATTGGTGCCCCAGATATAGCATTCCCTCGAATAAACAATATAAGCTTTTGACTCCTCCCTCCCTCTTTCTTACTACTTTTAGCATCATCTATAGTTGAAGCTGGCGCAGGGACAGGCTGAACTGTGTATCCCCCTCTAGCTGGCAACCTAGCTCACGCAGGAGCTTCAGTAGACTTGACTATTTTTTCTTTACATCTGGCAGGTGTCTCTTCAATTCTGGGGGCCATTAACTTTATTACAACAATTATTAATATAAAACCCCCTGCTATATCACAATATCAAACCCCTCTATTTGTGTGATCCGTACTAGTCACTGCTGTACTCCTACTTCTCTCACTCCCTGTACTAGCAGCCGGAATTACAATACTATTAACAGACCGAAACTTAAATACGACCTTTTTTGACCCAGCAGGAGGCGGAGATCCCATCCTATATCAACACTTGTTCTGATTCTTTGGCCACCCTGAAGTATATATCCTTATTCTACCCGGCTTTGGCATAATCTCCCACATCGTAACATACTACTCAGGAAAAAAAGAACCATTTGGGTACATAGGAATGGTCTGGGCTATAATATCAATTGGGTTCTTAGGATTTATTGTATGAGCCCACCACATATTTACAGTCGGAATAGATGTTGACACACGAGCCTATTTCACATCAGCTACCATAATTATTGCCATCCCAACTGGAGTAAAAGTCTTTAGTTGGTTAGCAACACTCCATGGAGGTAATATTAAATGATCACCTGCTATAATATGAGCTTTAGGCTTTATTTTCCTTTTTACAGTCGGAGGCTTAACCGGGATTGTTCTTGCCAACTCTTCTCTCGACATTGTCCTTCATGACACATATTATGTAGTTGCACACTTCCACTATGTACTGTCAATAGGAGCTGTATTTGCTATTATAGGAGGATTTGTTCACTGATTCCCACTATTCTCAGGTTATACTCTCAACGACACATGAGCCAAAATCCACTTTGTGATTATATTTGTAGGAGTAAATATAACTTTCTTTCCACAACACTTCCTAGGGTTGTCTGGCATGCCACGACGTTACTCTGATTACCCAGATGCATACACAATATGAAACACCATTTCATCCATAGGCTCATTTATCTCTTTAACAGCAGTTATATTAATAATCTTCATTATCTGAGAAGCGTTCGCGTCCAAACGAGAAGTCTCAACCGTAGAATTAACAACAACAAACCTAGAATGACTAAATGGATGCCCTCCACCATATCATACATTTGAAGAACCTACATACGTTAACTTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Elaphurus davidianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EW
Extinct in the Wild

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Jiang Zhigang & Harris, R.B.

Reviewer/s
Black, P.A. & Gonzalez, S. (Deer Red List Authority)

Contributor/s

Justification
This species is listed as Extinct in the Wild, as all populations are still under captive management. The captive population in China has increased in recent years, and the possibility remains that free-ranging populations can be established some time in the near future. When that happens, its Red List status will need to be reassessed.

History
  • 1996
    Critically Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

E. davidianus is critically endangered by the IUCN.

CITES: no special status

IUCN Red List of Threatened Species: extinct in the wild

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Extinct in the Wild (EW) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
After decades of ex situ conservation, the species breeds successfully in captivity (Beck and Wemmer 1983). In China there are now fenced populations in Beijing, Dafeng, Tianezhou and Yuanyang.

The first conservation reintroduction of Père David’s deer to China included two groups, of 20 deer (5 males : 15 females) and 18 deer (all females), in 1985 and 1987, respectively. All 38 deer were donated by the Marques of Tavistock of Woburn Abbey, and the transportation was sponsored by the World Wildlife Fund (WWF). After a careful search and evaluation by a group of zoologists, botanists, wildlife managers and officers, the relic site of the Nanyuang Royal Hunting Garden in the southern suburbs of Beijing was chosen as the site of re-introduction, creating the Beijing Milu Park (39°07'N, 116°03'E), with an area of 60 ha. The deer in the park have received supplemental feeding year round (Jiang et al. 2000a).

The second re-introduction of E. davidianus was carried out in August of 1986, organized by former Ministry of Forestry and WWF. A group of 39 Père David’s deer was selected from five zoological gardens in the United Kingdom, with the deer mainly from the Whipsnade Wild Animal Park. An extensive search which covered a vast area in eastern China for a potential reintroduction site was conducted before a decision was made. The Dafeng State-Owen Forestry Farm was chosen, on the Yellow Sea coast in eastern China in a lightly populated area (semi-fossils of Père David’s deer have been excavated from the neighbouring counties, so this site is probably in its natural habitat). The introduced herd was released into three fenced paddocks, each about 100 ha in area. The reserve purchased another 30 km² land in 1995, more than doubling its original size. In 1997, the Dafeng Milu Natural Reserve was approved by the National Nature Reserve Commission as a national nature reserve. The Dafeng Milu Nature Reserve has the potential to host a large population of Père David’s deer. The reserve has kept the reintroduced Père David’s deer and their offspring on its land, and in 1998 the first group of deer was released from the paddocks into the wider reserve (Hu and Jiang 2002). In 2003, and 2006 another two groups of deer were released from the paddocks. There were 950 Père David’s deer in the reserve in 2006. The annual average population growth rate of deer in the reserve was 17.01%. This Père David’s deer conservation strategy calls for further expanding of the Dafeng Milu Nature Reserve (Jiang et al., 2000b).

The Beijing Milu Park is in a suburb of the national capital with a limited area and is engulfed by city development, whereas the Dafeng Milu Nature Reserve is located in a remote costal region with little human settlement, where it is possible to acquire more land for conservation. Therefore, the Beijing Milu Park while keeping a healthy nuclear breeding herd of about 100 deer at the park, has shipped Père David’s deer to other sites in east China (Yang, 2007). The translocations thus reduced the grazing pressure on the park vegetation and expanded the distribution range of the Père David’s deer in the country. The average annual population growth rate for Père David’s deer in Beijing Milu Park from 1987-1997 was 17.3%. This Père David’s deer conservation strategy calls for an expansion of this artificial dispersal of animals to establish new sites (Jiang et al., 2000b).

E. davidianus from the Beijing Milu Park have been relocated to the lower reaches of the Yangtze River in eastern China and Hainan Island in the South China Sea. In October 1993, a group of 30 Père David’s deer (8 males : 22 females) arrived and was released in a paddock on a small peninsular in the Yangtze River, Tianezhou (29°49'N,112°33'E). This site was then established as the Tianezhou Milu Nature Reserve in 1993. The size of the reserve is 11.67 km². Another group of 34 Père David’s deer (10 males : 24 females) was transferred from the Beijing Milu Park to the Tianezhou paddock in the following year to enlarge the population. An additional 30 deer (15 males : 15 females) were released into the paddock of the reserve in 2002. The relocated deer reproduced in the second year after the relocation (Yang et al, 2002). By the end of calving season of 2006, there were 522 E. davidianus in the Tianezhou Milu National Nature Reserve. The annual average population growth rate was 22.2%. The birth rate and population growth rate in Tianezhou were significantly higher whereas the mortality rate was significantly lower than those of the Dafeng.

In November, 2002, 30 E. davidianus (14 males : 16 females) from Beijing Milu Park and 20 from the Dafeng Milu Nature Reserve were introduced to Yuanyang Forestry Farm, Henan. These deer are in an enclosure on the Yuanyang Yellow River Nature Reserve (35°11'N, 114°15'E). In 2006, there were 53 deer in the Yuanyang Yellow River Nature Reserve paddock, but the sex ratio was predominately male biased (38 males : 15 females) (Li et al. 2007).

Currently, there are a total of 53 herds of E. davidianus in China. Nine herds have fewer than 25 deer, 75.5% have fewer than 10 deer (Yang et al., 2003). Such a small herd size raise question about the effective population size and health of population genetics, since those herds are isolated and there is no gene exchange. The artificially dispersed E. davidianus herds are similar to a meta-population. The viability of the meta-population depends on the man-made gene exchange process by the managers.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species became extinct in the wild due to habitat loss and hunting. The size of the reintroduced population was only 120 in 1993 (Cao 1993), although has increased to over 2,000 since that time (Yang et al. 2008). Low genetic diversity has been identified as a long-term threat by Zeng et al. (2007) and Yang et al. (2008). It is unclear how much native habitat remains on which E. davidianus can exist in a free-ranging state.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

As inhabitants of open marshland and plains, this deer was easily hunted and suffered huge population losses in the 19th century (5). At this time the Emperor of China established a large herd in his 'Imperial Hunting Park' where the deer thrived. Pere David, a French missionary, became fascinated by these animals and persuaded the Emperor to allow some deer to be sent to Europe (6). Shortly after this, in May 1865, there were catastrophic floods in China, killing the entire population of Pere David's deer. Fortunately the captive populations in Europe bred well, and in 1986 a small group of 39 individuals was reintroduced to the Dafeng Nature Reserve in China (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on the Chinese Red List as Extinct in the Wild, and on the China Key List - I. The present re-introduced populations are contained within enclosures and are essentially still subject to captive management.

Recommended conservation action includes:
1. Establish additional populations when and where appropriate, with the aim of re-establishing a genuinely wild, free-ranging population.
2. Establish a genetic management programme of all populations in China.
3. Develop conservation education programmes to raise conservation awareness among the local people and general public.

Following a trial release of this species in the Dafeng Reserve, China, Hu and Jiang (2002) concluded that future releases will necessitate either natural or artificial boundaries to alleviate conflict between introduced E. davidianus and farmers, on whose land the deer are likely to stray. These authors suggest a reintroduction model based on that of Oryx leucoryx in Oman (Stanley Price 1989).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The present reintroduced population within the Dafeng Nature Reserve is contained within enclosures, where it is subject to captive management and is protected from hunting. Over the years, this population has increased in numbers, and it is hoped that at some point in the future, a free-ranging population could be established in China (1) (3). This species was saved from the brink of extinction and is making a slow but steady recovery. It is, however, dependant on conservation measures and captive management and so it is essential that these efforts are continued (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

None cited

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

This species is farmed for food and can also be found in hunting parks.

Positive Impacts: ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Père David's deer

Père David's deer
Chinese麋鹿
Literal meaningElk-deer

Père David's deer (Elaphurus davidianus), also known as the milu (Chinese: 鹿; pinyin: mílù) or elaphure, is a species of deer that is currently extinct in the wild—all known specimens are found only in captivity. This semiaquatic animal prefers marshland, and is native to the subtropics of China. It grazes mainly on grass and aquatic plants. It is the only extant member of the genus Elaphurus. Based on genetic comparisons, Père David's deer is closely related to the deer of the genus Cervus, leading many experts to suggest merging Elaphurus into Cervus,[2] or demoting Elaphurus to a subgenus of Cervus.[3]

Contents

Naming and etymology [edit]

Père David's deer (female).

This species of deer was first made known to Western science in 1866 by Armand David (Père David), a French missionary working in China. He obtained the carcasses of an adult male, an adult female and a young male, and sent them to Paris, where the species was named Père David's Deer by Alphonse Milne-Edwards, a French biologist.[1]

The species is sometimes nicknamed sibuxiang (Chinese: 四不像, pinyin: sì bú xiàng), literally meaning "four not alike", which could mean "the four unlikes" or "like none of the four"; it is variously said that the four are cow, deer, donkey, horse (or) camel, and that the expression means in detail:

  • "the hooves of a cow but not a cow, the neck of a camel but not a camel, antlers of a deer but not a deer, the tail of a donkey but not a donkey."
  • "the nose of a cow but not a cow, the antlers of a deer but not a deer, the body of a donkey but not a donkey, tail of a horse but not a horse"
  • "the tail of a donkey, the head of a horse, the hoofs of a cow, the antlers of a deer"
  • "the neck of a camel, the hoofs of a cow, the tail of a donkey, the antlers of a deer"
  • "the antlers of a deer, the head of a horse and the body of a cow"[4]

By this name, this undomesticated animal entered Chinese mythology as the mount of Jiang Ziya in Fengshen Bang (translated as Investiture of the Gods), a Chinese classical work of fiction written during the Ming Dynasty.

Characteristics [edit]

The adult Père David's deer reaches a head-and-body length of up to 1.9–2.2 meters (6.2–7.2 ft) and stands about 1.2 meters (3.9 ft) tall at the shoulder.[5] The tail is relatively long for a deer, measuring 50–66 centimeters (20–26 in) when straightened. Weight is between 135 and 200 kilograms (300 and 440 lb). The head is long and slender with large eyes, very large preorbital glands, a naked nose pad and small, pointed ears.[6]

The branched antlers are unique in that the long tines point backward, while the main beam extends almost directly upward. There may be two pairs per year. The summer antlers are the larger set, and are dropped in November, after the summer rut. The second set—if they appear—are fully grown by January, and fall off a few weeks later.[6]

The coat is reddish tan in the summer, changing to a dull gray in the winter. Long wavy guard hairs are present on the outer coat throughout the year, with the coat becoming woolier in winter. There is a mane on the neck and throat and a black dorsal stripe running along the cervicothoracic spine. The tail is about 50 centimeters (20 in) in length, with a dark tuft at the end. The hooves are large and spreading, and make clicking sounds (as in the reindeer) when the animal is moving.[6]

The gestation period is about nine months, after which a single offspring is usually born; twins are born in rare cases. The juveniles (referred to as either fawns or calves) have a spotted coat, as is commonly seen in most species of deer. They reach sexual maturity at about 14 months.[6] Historically, their main predators are believed to have been tigers and leopards. Despite no longer encountering ancestral predators, when experimentally exposed to images and stimuli relating to these big cats, the deer seemed to instinctively react with a cautious predator response typical of wild deer.[7]

A semiaquatic animal, Père David's deer swims well, spending long periods standing in water up to its shoulders. Although predominantly a grazer, the deer supplements its grass diet with aquatic plants in the summer.

Population [edit]

Père David's deer (male). Note the large preorbital glands, backwards pointing antlers, black dorsal stripe along the vertebral column and large, spreading hooves.

In neolithic times, the range of the milu's range extended across much of China Proper. Archaeologists have found milu antlers at settlements from the Liao River in the north to Jiangsu and Zhejiang Province and across the Yellow and Yangtze River Basins in Shaanxi and Hunan Province.[8]

Extinction in China [edit]

In the late 19th century, the world's only herd belonged to Tongzhi, the Emperor of China. The herd was maintained in the Nanyuang Royal Hunting Garden in Nan Haizi, near Peking.[9] In 1895, one of the walls of the hunting garden was destroyed by a heavy flood of the Yongding River, and most of the animals escaped and were killed and eaten by starving peasants. Fewer than thirty Père David's Deer remained in the garden. Then in 1900, during the Boxer Rebellion, the garden was occupied by troops and the remaining deer were shot and eaten, leaving the animal extinct in its native China.[1]

Fortunately, a few of the deer had previously been illegally transported to Europe for exhibition and breeding. After the extirpation of the Chinese population in 1900, Herbrand Russell, 11th Duke of Bedford, was instrumental in saving the species. He acquired the few remaining animals from European zoos and nurtured a herd at Woburn Abbey. Threatened again by both World Wars, the species survived largely due to the efforts of Bedford and his son Hastings, later 12th Duke of Bedford. The current world population, now found in zoos around the world, stems from the Woburn Abbey herd.[10]

Reintroduction [edit]

Reintroduction of Père David's deer to China began in 1985, with a herd of 20 deer (5 males and 15 females). This was followed in 1987 by a second herd, consisting of 18 deer (all females). Both herds had been drawn from the Woburn Abbey herd and were donated by the 12th Duke's grandson and successor, John. The transportation was sponsored by the World Wildlife Fund. The relic site of the Nanyuang Royal Hunting Garden in the southern suburbs of Beijing was chosen as the site of re-introduction, creating the Beijing Milu Park.[1] Of the 20 taken to China, in 1985, after 20 years of conservation the population had expanded to around 2000.[11]

A second re-introduction into China was conducted in 1986 where 36 Père David’s deer were chosen from five UK zoological gardens with the bulk of the deer coming from Whipsnade Wild Animal Park. These deer were introduced into Dafeng Milu Nature Reserve, near the Yellow Sea coast in eastern China. In 2006 the population at this Nature Reserve had reached around 950 with an average annual population increase of 17%.[1]

In 1993, 30 deer taken from the herd at Beijing Milu Park were released into the Tianezhou Milu National Nature Reserve. These were followed by another 34 deer taken from Beijing Milu Park and released into the Tianezhou Reserve. The average annual population growth rate for Père David’s deer in Tianezhou Nature Reserve was 22.2%.[1]

In 2002, 30 deer taken from the herd at Beijing Milu Park and 20 from Dafeng Nature Reserve were released into the Yuanyang Yellow River Nature Reserve.[1]

When the species was assessed for the IUCN Red List (1996), it was classified as "critically endangered" in the wild, under criterion "D": "[wild] population estimated to number less than 50 mature individuals".[12] Since October 2008, they have been listed as extinct in the wild, as all populations are under captive management. In spite of the small population size, the animals do not appear to suffer genetic problems from the genetic bottleneck. The captive population in China has increased in recent years, and the possibility remains that free-ranging populations can be reintroduced in the near future.[1]

Legend and cultural significance [edit]

According to Chinese legend, when the tyrant King Zhou of Shang ruled the land more than 4,000 years ago, a horse, a donkey, an ox and a deer went into a cave deep in the forest to meditate and on the day the King executed his virtuous minister Bigan, the animals awoke from their meditation and turned into humans.[13] They entered society, learned of the King's heinous acts and wanted to take recourse against the King, who was powerful.[13] So they transformed themselves into one creature that combined the speed of the horse, the strength of the ox, the donkey's keen sense of direction and the nimble agility of the deer.[13] This new animal then galloped to the Kunlun Mountains to seek the advice of the Primeval Lord of Heaven. The Lord was astonished at the sight of a creature that had antlers of a deer, hooves of an ox, face of deer and tail of a donkey. "It's unlike any of four creatures!" he exclaimed. Upon learning of the animal's quest, Lord gave his blessing and dispatched the creature to his disciple the sage Jiang Ziya, who was battling the King.[13] Jiang Ziya rode the creature to victory over the King and helped found the Zhou Dynasty. After fulfilling its vow, the milu settled in the lower reaches of the Yangtze River.[13] The animal became a symbol of good fortune and was sought by later emperors who believed eating the meat of the milu would lead to everlasting life.[13] By the Han Dynasty, about 2,000 years ago, the milu was already extinct in the wild, but kept in imperial hunting grounds.

See also [edit]

References [edit]

  1. ^ a b c d e f g h Zhigang, J; Harris, RB (2008). Elaphurus davidianus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 2012-05-20.
  2. ^ Pitra, C.; Fickel, J.; Meijaard, E.; Groves, C. (1 December 2004). "Evolution and phylogeny of old world deer". Molecular Phylogenetics and Evolution 33 (3): 880–895. doi:10.1016/j.ympev.2004.07.013. Retrieved 18 April 2013. 
  3. ^ Geist, V. (1998). Deer of the World: their Evolution, Behaviour and Ecology (1st ed.). Mechanicsburg, PA: Stackpole Books. p. 81. ISBN 0811704963. 
  4. ^ "China To Return More David's Deer To the Wild". People's Daily Online. January 13, 2000. Retrieved 2012-05-21. 
  5. ^ Burnie, D. and Wilson, DE (Eds.), Animal: The Definitive Visual Guide to the World's Wildlife. DK Adult (2005), ISBN 0789477645
  6. ^ a b c d "Père David's Deer (Elaphurus davidianus)". Deer. Gland, Switzerland: World Association of Zoos and Aquariums. 2012. Retrieved 2012-05-20. 
  7. ^ Li, Chunwang; Yang, Xiaobo; Ding, Yuhua; Zhang, Linyuan; Fang, Hongxia; Tang, Songhua; Jiang, Zhigang; Hayward, Matt (August 24, 2011). "Do Père David's Deer Lose Memories of Their Ancestral Predators?". PLoS ONE 6 (8): e23623. doi:10.1371/journal.pone.0023623. 
  8. ^ (Chinese) 王蕾, 麋鹿与狩猎 2007-12-17
  9. ^ Twigger, R (2003). "Milu". The Extinction Club. New York: HarperCollins Publishers. pp. 56–61. ISBN 0060535962. 
  10. ^ Goodall, J; Maynard, T; Hudson, G (2009). "Milu or Père David's Deer, China". Hope for Animals and their World: How Endangered Species are being Rescued from the Brink. New York: Grand Central Publishing. pp. 39–46. ISBN 978-0446581776. 
  11. ^ "Père David’s deer". britannica. 2012. Retrieved 2012-11-20. 
  12. ^ The IUCN Red List of Threatened Species
  13. ^ a b c d e f (Chinese)麋鹿文化--麋鹿的传说 2012-04-11

Further reading [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!