Overview

Distribution

Range Description

This species is now restricted to eastern China (in southeastern Anhui, northern Fujian, northeastern Jiangxi, and western Zhejiang (Ohtaishi and Gao 1990, Wu et al. 2007), with a few outlying records from eastern Zheijiang. Its range formerly extended from the coastal region of Ningbo at the mouth of the Yangtze River, westward to Guangdong province (Ohtaishi and Gao 1990). Records from Yunnan and Myanmar refer to Muntiacus gongshanensis. Animals are restricted to altitudes of 200-1,000 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The documented geographic range of Muntiacus crinifrons includes the Anhui, Fujian, Jiangxi, and Zhejiang provinces of eastern China as well as within the Hkakabo Razi National Park of northern Myanmar. Ohtaishi and Gao (1990) suggested that the range of M. crinifrons formerly extended from the mouth of the Yangtze River, through the southeastern provinces that border the South China Sea, and into Yunnan province. Fragmentation of the former distribution of M. crinifrons may have been caused by deforestation for logging and agricultural purposes.

Biogeographic Regions: palearctic (Native ); oriental (Native )

  • Groves, C., P. Grubb. 1990. Muntiacidae. Pp. 134-168 in G Bubenik, A Bubenik, eds. Horns, Pronghorns, and Antlers. New York: Springer-Verlag.
  • Lu, H., H. Sheng. 1984. Status of the Black muntjac, Muntiacus crinifrons, in eastern China. Mammal Review, 14/1: 29-36.
  • Rabinowitz, A., G. Amato, U. Saw Tun Khaing. 1998. Discovery of the black muntjac, Muntiacus crinifrons (Artiodactyla, Cervidae), in north Myanmar. Mammalia, 62: 105-108.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

One of the larger species of the genus Muntiacus, M. crinifrons can have a body mass as large as 28.5 kg, with females, on average, larger than males (24.1 kg and 23.1 kg, respectively). The pelage is mostly black to dark brown in color. The thick and long frontal tuft above and between the eyes is cinnamon red in color and often hides the long pedicles of the antlers. The tail is notably longer than in other species of Muntiacus (~21 cm) and is thickly tufted with white fur that extends onto the inner thighs. The ventral side is only slightly lighter in color compared to the dorsal side. During winter, the coat is much thicker and darker, but becomes thinner and lighter in color during the summer. Muntiacus crinifrons fawns have a coat similar to that seen in adults, except for the addition of four dorsal, subparallel, white spots.

Like other members of the subfamily Cervinae, M. crinifrons retain enamel-covered upper canines, which are elongated into tusks in males. In M. crinifrons, only males bear short (20-60 cm), single-branched antlers on long, hair-covered pedicles (8-10 cm) that extend from the frontal bone. Annual shedding of the antlers is presumed to occur by many authors. However, Groves and Grubb (1990) raise the possibility that the antlers are not always shed, because of observed similarities in antler size and morphology between M. crinifrons and M. atherodes, a species in which the frontal cavity extends into the pedicle preventing the development of a burr.

Range mass: 21.3 to 36.1 kg.

Range length: 98 to 113 cm.

Average length: 103.9-105.8 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs mostly in heavily forested mountain areas, with abundant undergrowth (Ohtaishi and Gao 1990), as well as mixed forest and scrub (Sheng Helin and Zhang Endi, East China Normal University pers. comm.). The species appears to be a generalist browser/frugivore, its diet includes a wide variety of tree leaves and twigs, forbs, grasses, and fruits. Zheng et al. (2006) found that most sign of M. crinifrons in a study area in Suichang county, Zhejiang province was found in mixed forests, although conifer forests increased in importance during winter. M. crinifrons seemed to prefer relatively high tree canopy cover in relatively high elevation (> 800 m) zones with little human disturbance. They apparently display rather limited dispersal capability (Wu et al. 2005, 2006, 2007).

The reproductive cycle is aseasonal, and some females conceive new litters while still lactating. Young are born throughout the year. Gestation is 210 days, and mothers give birth to single fawns. Sexual maturity is reached at one year (Sheng and Ohtaishi 1993).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Muntiacus crinifrons inhabits hilly, often precipitous, mountain forests between 800-1000 m above sea level. These forests consist of a mosaic of deciduous broadleaf, evergreen, and bamboo patches with dense undergrowth and subtropical monsoonal conditions.

Range elevation: 800 to 1000 m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Some species of Muntiacus have been described as omnivorous. However, a study of the rumen contents of Muntiacus crinifrons showed that the diet consists of leaves, twigs, and fruit without any animal matter. The contents included woody shrubs and vines, fallen fruit, herbs and grasses, conifers, and bamboo leaves, in order of decreasing abundance.

Plant Foods: leaves; wood, bark, or stems; fruit

Primary Diet: herbivore (Folivore , Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Muntiacus crinifrons is expected to be an ecological specialist due to its preference for a specific range of altitudes (800-1000 m). This is further supported by the exclusion of other deer species, who occupy similar habitats and altitudes elsewhere in China, from their ranges. Since this species has been found to eat fallen fruit, Muntiacus crinifrons may be important in seed dispersal. Beyond this, little is known about the ecological role of Muntiacus crinifrons.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The main predators of Muntiacus crinifrons are humans and dholes. Leopards are also suspected to prey upon M. crinifrons, but cases of leopard predation have not been documented. Muntiacus crinifrons uses visual and sound cues (as described above) to inform a predator that it has been detected in order to dissuade the predator from attacking. Other species of Muntiacus quickly flee predators down well-maintained trails and hide in the dense undergrowth until the danger has passed. A similar behavior is expected of M. crinifrons.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

As mentioned above, M. crinifrons scent marks with secretions from frontal and preorbital glands to demarcate territorial boundaries. Such scent marks may also indicate reproductive status. Visual cues, such as a raised frontal tuft or exposed white fur of the upturned tail, as well as barking, convey anxiety and may inform a predator or opponent that it has been spotted. Studies of reproductive behavior in Muntiacus reevesi report that males use low postures and "buzzing" noises during courtship, but such behavior in M. crinifrons has not been documented.

Communication Channels: visual ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of Muntiacus crinifrons is not well known. Lu and Sheng (1984) report capturing a pregnant female of 11 years in age. This implies that M. crinifrons may have a lifespan similar to the 10-12 year lifespan estimated for Muntiacus reevesi.

Range lifespan

Status: wild:
11 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals, but one wild born specimen was still alive in captivity at about 12 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The details of the mating system is not known specifically for M. crinifrons. However, the behavior of M. reevesi is often used as a paradigm for other members of the genus. Males of that species demarcate and aggressively defend small territories exclusive of other males, these territories may overlap with those of several females.

Mating System: polygynous

Black muntjacs breed continually throughout the year without a distinct breeding season (polyestrous). Females may enter estrous before acquiring full body size. They bear only one fawn per pregnancy. In one study, some lactating females were found carrying fetuses, implying that post-partum estrus is possible in this species. The gestation period is not known for M. crinifrons, but in M. reevesi gestation lasts 209-220 days. The dappled coat of the fawn indicates that the young spend some time hidden in forest undergrowth until they are large enough to follow their mothers.

Breeding interval: Females may give birth up to once a year.

Breeding season: Breeding can occur throughout the year.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female): 1 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; post-partum estrous

Little is known about the parental investment of Muntiacus crinifrons. However, in other species of Muntiacus, maturation progresses rapidly and females may simultaneously carry one young in utero while nursing another. Both observations imply relatively little postpartum parental investment by the mother.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Dueling, S., P. Myers. 2004. "Muntiacus reevesi" (On-line). Animal Diversity Web. Accessed March 21, 2006 at http://animaldiversity.ummz.umich.edu/site/accounts/information/Muntiacus_reevesi.html.
  • Lu, H., H. Sheng. 1984. Status of the Black muntjac, Muntiacus crinifrons, in eastern China. Mammal Review, 14/1: 29-36.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Muntiacus crinifrons

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0583-06|NC_004577|Muntiacus crinifrons| AACCGTTGATTATTTTCAACTAATCATAAAGACATCGGCACCCTCTACCTACTATTCGGTGCCTGAGCAGGCATAGTAGGAACAGCTCTA---AGCCTATTAATTCGTGCTGAACTGGGTCAACCGGGAACCCTACTTGGAGAT---GACCAAATTTATAACGTAATTGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTGATACCTATTATAATTGGAGGATTCGGTAATTGACTGGTTCCCTTAATA---ATTGGCGCTCCAGACATAGCATTTCCCCGAATAAATAACATAAGCTTCTGGCTTCTCCCACCCTCTTTCCTACTACTTCTAGCATCATCTATAGTTGAAGCTGGCGCAGGAACAGGCTGAACTGTATATCCCCCTCTAGCCGGTAATCTGGCCCATGCAGGAGCTTCAGTAGATCTA---ACTATTTTTTCCTTGCACCTAGCAGGTGTCTCCTCAATTTTAGGGGCCATTAACTTTATTACAACAATCATTAATATAAAACCCCCTGCCATATCACAATATCAAACCCCCCTGTTCGTGTGATCCGTACTAATTACCGCTGTGTTGCTACTTCTCTCACTTCCTGTGCTAGCAGCC---GGAATTACAATACTATTAACAGACCGAAATCTAAATACAACTTTCTTTGACCCAGCAGGAGGTGGAGACCCTATTCTGTATCAACACCTGTTCTGATTCTTTGGCCACCCTGAAGTATATATTCTTATCCTACCCGGCTTTGGTATAATTTCTCACATCGTAACATACTATTCAGGAAAAAAA---GAACCATTTGGATATATAGGAATAGTCTGAGCCATGATATCAATTGGATTCTTAGGATTTATTGTATGAGCTCACCACATGTTTACAGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Muntiacus crinifrons

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cd

Version
3.1

Year Assessed
2008

Assessor/s
Harris, R.B.

Reviewer/s
Black, P.A. & Gonzalez, S. (Deer Red List Authority)

Contributor/s

Justification
Listed as Vulnerable because of a probable serious population decline, estimated to be more than 30% over the last three generations (approximately 18 years), inferred from over-exploitation, shrinkage in distribution, and habitat destruction and degradation. Although there is no direct data available regarding recent declining population rates, the above-mentioned rate of decline seems reasonable based on the high levels of harvesting and habitat loss. It should also be noted that:
1) The last population assessment accounted for only 7,000 to 8,500 individuals living in the wild, in eastern China (Sheng 1998), though the basis for these numbers is not clear.
2) The distribution range of the species is rather limited, and the species appears to slow to colonize new areas (Ohtaishi and Gao 1990, Wu et al. 2007).
3) Threats, to the survival of the species, are in all likelihood still present (Ohtaishi and Gao 1990, Wu et al. 2007).

History
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Indeterminate
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Indeterminate
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The geographic range of Muntiacus crinifrons is presumed to have been much more extensive is southeast Asia in the past, but has recently been fragmented due to habitat loss. In China, habitat loss has been attributed to overexploitation of mountain forests for timber as well as forest clearing for agriculture and infrastructure development. Overhunting may also play a role in the declining numbers of M. crinifrons.

During the early 1980's, the estimated population size of Muntiacus crinifrons in China was ~ 10,000 individuals. However, a 1989 estimate lowered the population size to between 5000-6000 individuals. The discovery of Muntiacus crinifrons in Myanmar suggests that the total population size may be closer to 12,000 individuals.

US Federal List: no special status

CITES: appendix i

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is endemic to China. In 1989 the total Chinese population was estimated around 5,000-6,000 individuals by Ohtaishi and Gao (1990); Sheng (1998) estimated the population to number approximately 7,000 to 8,500. However, the basis for these population estimates is not known. Hunting and habitat destruction have negatively affected its geographic distribution and abundance (Sheng, 1998). A possible decrease in numbers during the late eighties was inferred by Ohtaishi and Gao (1990). Among the three main distribution centers of this species in eastern China there has developed a degree of genetic differentiation that Wu et al. (2006) attributed to the reduction of female-mediated gene flow stemming from habitat fragmentation. Although Wu et al. (2007) found a comfortingly large degree of nuclear genetic diversity; they nevertheless confirmed the earlier conclusions of Wu et al. (2005, 2006) based on mtDNA that the species had been fragmented into subpopulations. The species is believed to be in decline because of hunting and habitat loss.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Numbers of this species continue to decline due to deforestation, expanding agriculture, hunting, and other human disturbances. The species is hunted for venison and skin. Ohtaishi and Gao (1990) reported that 500 animals were being killed annually for skins which were sold to local markets during the 1980s. Sheng (1998) reported that yearly harvest may have exceeded this figure. There are no current data available regarding human predation on the species, but considering the chronic nature of the poaching problem in China there is no reason to assume that the species is not affected by it.

The species is hunted for venison and skin. Ohtaishi and Gao (1990) reported that 500 animals were being killed annually for skins which were sold to local markets during the 1980s. Sheng (1998) reported that yearly harvest may have exceeded this figure. There are no current data available regarding human predation on the species, however, considering the chronic nature of the poaching problem in China there is no reason to assume that the species is not affected by it.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
M. crinifrons is listed on Appendix I of CITES. On the Chinese Red List this species is termed Endangered A2bcd (Smith and Xie 2008), and it protected by the 1988 Chinese National Wildlife Law under category I. It presumably exists in some protected areas, but no active conservation measures are currently in place for this species. Recommended conservation actions include initiation of research to determine status and threats throughout the species' range. Activities should include field reconnaissance, population censuses, demographic surveys, ecological studies and investigations into human use of the animals. The highest priority is to conserve the forest habitat of this species, and to bring poaching under strict control.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Muntiacus crinifrons inhabits mountainous areas with little or no human populations and have no negative impact on human economies.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In both China and Myanmar Muntiacus crinifrons is hunted and trapped for its meat and skin. Local people in Myanmar sell the skins and antlers to Chinese traders for essential items and amenities.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hairy-fronted Muntjac

The Hairy-fronted Muntjac or Black Muntjac (Muntiacus crinifrons) is found in Zhejiang, Anhui, Jiangxi and Fujian in South China, also reported in North-East India, northern Myanmar and Southern Tibet. Although extremely difficult to study because of its shyness, it is considered to be endangered, possibly down to as few as 5–10,000 individuals spread over a wide area. It is a similar size to the common muntjac.

This species was for a very long time one of the most poorly known deer in the world. It was also considered highly endangered; up to 1975, it was only known from a few museum specimens, at least to western scientists. The species has been heavily harvested throughout the 20th century and in 1978 at least 2,000 animals were killed. The current population in China was assessed in the early 1990s to be ca 10,000 animals however it has declined much since and the current population is likely to be well under 7,000.

The species was considered endemic only to China for a long time, although a survey in North-eastern Myanmar (close to the Chinese border) was carried out as early as 1938 after reports of a black barking deer there. That expedition failed to find any specimens and it was only in 1997 that two expeditions discovered evidence suggesting that the species was endemic to North-eastern Myanmar. A few dozen skins and antlers of animals killed by hunters were collected from several villages by the first expedition, and over 50 skins were found during the second survey, exhibiting similarities to the animals in China; DNA samples taken from the collected skins showed that the animals collected in Myanmar were identical to animals found in China. The number of animals in Myanmar is suggested to be similar to those in China, bringing up the total world population to some 10,000-13,000 animals.[citation needed]

References

  1. ^ Harris, R.B. (2008). Muntiacus crinifrons. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 5 April 2009. Database entry includes a brief justification of why this species is of vulnerable.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!