Overview

Distribution

Range Description

Southern Red Muntjac, as defined here, occupy part of the Thai–Malay peninsula and occurs on the main islands of the Greater Sundas (Borneo, Java, Bali and Sumatra) and on various small islands (Chasen 1940; Groves 2003; Meijaard 2003). On Sumatra, it is not geographically limited to southern and eastern parts of the island despite various statements that it is (R.J. Timmins pers. comm. 2008). Taking the northern limit on the peninsula as the Isthmus of Kra (see Taxonomy), M. muntjak (as here defined) is assumed to inhabit southern Thailand and might be found to occur in southernmost Myanmar. It is now extinct in Singapore (Baker and Lim 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Muntiacus muntjak can be found in southern and southeastern Asia, from Pakistan east through India and Nepal, across southeast Asia and southern China.

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Muntiacus muntjak, also known as the Indian muntjac, have small antlers present in males which are relatively short with long burrs. The females have tufts of hair and small bony knobs that are in the location of the antlers in males. They have a short coat of hair. The coat can be thick and dense for those living in cooler climates, or thin and less dense for those living in warmer areas. The color of the coat is golden tan on the dorsal side, white on the ventral side, and the limbs and face are dark brown. The ears have very little hair. These deer also posses tusklike upper canines measuring about 1 inch long in males. Their body length ranges from 89-135 cm. Their shoulder height and the length of their tail ranges from 40-65 cm and 13-23 cm respectively. The males tend to be larger than the females.

Range mass: 14 to 35 kg.

Range length: 89 to 135 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Southern Red Muntjac are associated with forest, but occur widely even in heavily degraded forest and, in areas adjacent to forest, in plantations of coffee, rubber, sugarcane, cassava, coconut, and teak (Oka 1998; Laidlaw 2000; Azlan 2006; G. Semiadi pers. comm. 2008). However, its ability to survive in landscape-level stands of teak is probably dependent upon the retention of fringes of secondary growth along streams, gullies and other such features (M. Tyson pers. comm. 2008) and this may be so for the other plantation species, too. Peak densities are probably not in pristine forest: in east Java, secondary forest with gallery forest mosaic seems to hold higher densities, and this muntjac may also benefit even from agricultural conversion at forest edges (M. Tyson pers. comm. 2008). Muntjac (presumed to be largely or entirely M. muntjak) abundance was higher in areas within 1 km of the protected area boundary than in the interior of Bukit Barisan Selatan National Park, Sumatra (although this pattern was only weakly statistically significant), suggesting an association with edge, broken and secondary habitats (O’Brien et al. 2003). In contrast, an avoidance of the edge of the Taman Negara protected area in Malaysia was suspected by Kawanishi and Sunquist (2004). In Danum Valley (Sabah, Borneo), an area with negligible hunting, M. muntjak strongly increased in densities after logging (Heydon 1994; Davies et al. 2001); a weaker increase was found by Duff et al. (1984). In the Sarawak Planted Forests, Bintulu Division, Sarawak, muntjacs (partly this species) are among the commonest species camera-trapped in young acacia plantations (under four years old) and have been seen browsing on young acacia shoots. Footprints are common in the adjacent newly planted areas and forest fragments (Belden Giman pers. comm. 2008). However, this area contains a substantial proportion of natural, if somewhat degraded, forest, which in theory might be found to be necessary for populations in the highly altered habitats. Information on the species in landscape-scale plantations, remote from even secondary forest, has not been traced. Most of its range is dominated by evergreen vegetation, but it readily uses deciduous forests and mosaics of grassland, scrub, and forest (e.g. on Java; Tyson 2007); on Bali and Java, M. muntjak routinely uses woodland savanna as a feeding ground (Oka 1998; S. Hedges pers. comm. 2008).

This muntjac has a wide altitudinal range. In Java, S. Hedges (pers. comm. 2008) has seen them over 0–800 m. In Sumatra, it occurs widely in the lowlands and the second species there, M. montanus, seems to be montane; whether M. muntjak ascends to the highest forests is yet unclear (R.J. Timmins pers. comm. 2008, based on examination of specimens). On Borneo, Red Muntjac lives up to at least 1,000 m asl on the Usun Apau plateau (Payne et al. 1985), who stated that “available data suggests that [M. atherodes] predominates over the Red Muntjac in low hill ranges and coastal regions”, but Meijaard and Sheil (2008) pointed out that still “no robust quantitative data exist to support this [pattern]”. Red Muntjac is scarcer than M. atherodes in Sungai Wain forest, Kalimantan, which spans 30–150 m asl (G.M. Fredriksson pers. comm. 2008), in the Sarawak Planted Forests, Bintulu Division, a mix of acacia plantation and natural forest (Belden et al. 2007; Belden Giman pers. comm. 2008), and (slightly so) in the Ulu Segama area of Danum Valley Conservation Area, Sabah, which lies mostly at about 300 m asl (Siew Te Wong pers. comm. 2008). In Borneo, muntjacs were frequently seen, suspected to comprise roughly equal numbers of Red and Yellow, in the Batang Ai National Park, Sarawak, which lies mostly at 100–760 m asl (Meredith 1995).

The diet is mostly fruits, buds, tender leaves, flowers, herbs and young grass (Kitchener et al. 1990; Oka 1998). In Taman Negara, Malaysia, camera-trapping showed Red Muntjac to be mostly diurnal (Kawanishi and Sunquist 2004) whereas in Gunung Leuser, Sumatra, it was classed as cathemeral (i.e., sporadic and random intervals of activity during the day or night) (van Schaik and Griffiths 1996) and this is true for East Java (S. Hedges pers. comm. 2008); there may be some variation between localities in balance of day and night activity. It is a mostly solitary species that is capable of breeding through the year, and has been stated to be territorial (Kitchener et al. 1990; Oka 1998). However, Tyson (2007) found no evidence of territoriality in radio-collared female muntjacs of Baluran National Park, Java, although range overlap declined in the rainy season compared with the dry season. Nor was there evidence of males using exclusive ranges in any season, or any clear evidence of territorial defence. As in the case of M. vaginalis, occasional sightings of small groups probably refer to mating pairs, or to females with offspring (Oka 1998), or to loose aggregations at abundant food resources (M. Tyson pers. comm. 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Muntjac habitat includes rain forests, areas of dense vegetation, hilly country, and monsoon forests. They like to be close to a water source.

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Muntjacs are omnivorous, feeding on herbs, fruit, birds' eggs, small animals, sprouts, seeds, and grasses. They use their canines to bite and their forelegs to deliver strong blows in order to catch small warm-blooded animals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
17.6 years.

Average lifespan

Status: captivity:
17.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 18.8 years (captivity) Observations: One captive specimen lived 18.8 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

In the first year of life, the female muntjac reaches sexual maturity. They are polyestrous with the estrous cycle lasting 14-21 days and the estrus lasting about 2 days. Breeding is not restricted to a specific time of the year. They usually bear just one young at a time. The gestation period is around 180 days and the weight at birth is between 550 and 650 g.

Average birth mass: 1223 g.

Average gestation period: 210 days.

Average number of offspring: 1.17.

Average age at sexual or reproductive maturity (male)

Sex: male:
332 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
272 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Muntiacus muntjak

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0178-06|AY225986|Muntiacus muntjak| AACCGCTGATTATTTTCAACTAACCATAAAGACATCGGCACCCTGTACCTACTATTCGGTGCCTGAGCAGGCATAGTAGGGACAGCCCTA---AGCCTATTAATTCGTGCTGAACTGGGTCAACCGGGAACCCTACTTGGAGAT---GATCAAATTTATAACGTAATTGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCCATTATAATTGGAGGATTCGGTAATTGACTGGTTCCTTTAATA---ATTGGTGCTCCAGACATAGCATTCCCTCGAATAAATAACATAAGCTTTTGGCTTCTCCCACCCTCTTTCCTTCTACTTCTAGCATCATCTATAGTTGAAGCTGGCGCAGGAACAGGCTGAACTGTATATCCCCCTCTAGCTGGTAATCTGGCCCATGCAGGAGCTTCAGTAGATCTA---ACTATTTTTTCTTTACACCTGGCAGGCGTTTCTTCAATTTTAGGGGCTATTAACTTTATTACAACAATTATTAATATGAAACCTCCTGCCATATCACAATATCAAACCCCTCTATTCGTGTGATCCGTACTAATTACCGCTGTATTGCTACTTCTCTCACTCCCTGTACTAGCAGCC---GGAATTACAATACTATTAACAGATCGAAATTTAAATACAACTTTTTTTGACCCAGCAGGAGGTGGAGACCCTATTCTGTACCAACACCTGTTCTGATTCTTTGGCCACCCTGAAGTATATATTCTTATTTTACCCGGCTTTGGTATAATTTCTCACATCGTAACATACTACTCAGGAAAAAAA---GAACCATTTGGATATATGGGAATGGTCTGAGCCATAATATCAATCGGATTTTTAGGATTTATCGTATGGGCTCACCACATGTTCACAGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Muntiacus muntjak

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Timmins, R.J., Duckworth, J.W., Hedges, S., Pattanavibool, A., Steinmetz, R., Semiadi, G., Tyson, M. & Boeadi

Reviewer/s
Black, P.A. & Gonzalez, S. (Deer Red List Authority)

Contributor/s

Justification
The Southern Red Muntjac is listed as Least Concern because it remains common throughout most of its range, is resilient to hunting and increases in numbers with logging and presumably other forms of forest disruption, and survives even almost complete conversion of forest to at least some crop plantations. Densities are probably widely below carrying capacity, particularly where habitat is highly fragmented. Its use of the hills means that most of the population is outside the very high forest conversion rates recently occurring in the Sundaic level lowlands, and gives it a healthier conservation outlook than that for M. atherodes with which it is sympatric on Borneo. The coming years will see further fragmentation and if hunting continues at current high levels, wider declines and a higher frequency of local extinction than has so far occurred. Nonetheless, future declines are unlikely to be fast enough to warrant listing the species even as Near Threatened.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

A study done in 1987 showed that there are 140,000-150,000 Muntiacus muntjak in China. They have been introduced in Texas, the Andaman Islands, and on Lombok. Muntjaks also thrive very well in zoos. The IUCN rates the species Lower Risk, Least Concern.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Recent camera-trap studies on all main occupied landmasses show this to be a common species. The following is only a part collation of existing studies. In Sumatra, muntjacs (not identified to species but presumed, given the habitats and altitudes, to be largely or entirely M. muntjak) were camera-trapped very commonly in Bukit Barisan Selatan National Park and around Gunung Leuser (van Schaik and Griffiths 1996; O’Brien et al. 2003). In Thailand, Red Muntjacs were recorded at over 40% of camera-trap locations in Kaeng Krachan National Park, a site that may contain either M. vaginalis or M. muntjak or both. Abundance did not vary with proximity to villages, even though a variety of hunting methods occurs on site (Ngoprasert et al. 2007). In West Malaysia, Red Muntjacs were commonly camera-trapped, at a high proportion of camera-sites, in Taman Negara, where densities were estimated at 3.2–4.05 per km² (Kawanishi and Sunquist 2004), were found to be ubiquitous and common at all nine potential Tiger Panthera tigris areas surveyed by Lynam et al. (2007), and were common in the Jerangau Forest Reserve, an area of secondary forest some of which was being logged at the time of study and where hunting was heavy enough to have eradicated (or reduced to very low densities) species such as Sambar Cervus unicolor (Azlan 2006). During a study of the mammals of West Malaysia’s virgin jungle reserves, they were found in 13 of 14 sites (seven virgin jungle reserves and seven adjacent logged areas), a much greater spread of occurrence than for most other mammals (Laidlaw 2000). In Java muntjacs have “persisted in many areas where there is some forest cover” (Whitten et al. 1996), were camera-trapped commonly in Ujung Kulon National Park (van Schaik and Griffiths 1996) and Gunung Halimun National Park (Suyanto 2003), and were studied in Baluran National Park (East Java) in the 1990s by Tyson (2007); the latter study found densities of 23–25 animals per km² in the park’s mosaic of open woodland, grassland, scrub at under 300 m asl during the dry season. These densities (considerably above those from Taman Negara) may be inflated by daily or seasonal movements of animals coming down to the coastal waterholes. The Baluran population may have benefited from a particular combination of seral processes including the growth of the exotic Acacia nilotica. Muntajcs remain locally very common on Bali (Oka 1998). Determining population status in Borneo is more difficult because of the difficulties of separation from M. atherodes, but it is clearly at least fairly common (Heydon 1994; for further discussion see Habitat and Ecology).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Habitat encroachment and hunting are both widespread in the Sundaic region. Indeed, they are often associated and all Borneo’s ungulates suffer from the increased hunting that often accompanies logging (Bennett and Dahaban 1995, Bennett and Gumal 2001), such that hunting to local extinction is the chief detrimental effect of logging on ungulates in Sarawak (Bennett and Gumal 2001). This conclusion probably is applicable across the Sundaic region. Southern Red Muntjac are widely hunted across its range (e.g. Bennett et al. 2000; Linkie et al. 2003; S. Hedges pers. comm. 2008, based on unpubl. data, East Java, 1991–2002); it is the most sought-after wild meat in Peninsular Malaysia (Kawanishi and Sunquist 2004) and is among the most preferred in Indonesia, although Sambar is the preferred species at least in East Kalimantan (Semiadi et al. 2004; Semiadi 2005).

However, there is no strong evidence that either hunting or habitat disruption are actually threats to the survival of populations except in the case of islands such as Singapore, where it is now extinct (Baker and Lim 2008). Peak densities are not in pristine forest (see Habitat and Ecology), and in Danum Valley (Sabah, Borneo), an area with negligible hunting, M. muntjak strongly increased in densities after logging (Heydon 1994; Davies et al. 2001); a weaker increase was found by Duff et al. (1984). Hence, even quite severe habitat disruption can increase ecological carrying capacity for this muntjac, at least temporarily.

In an area with heavy hunting, recorded densities of muntjacs (presumed M. muntjak) were twice as high in areas with low than with high human population density within 10 km of the Bukit Barisan Selatan National Park, Sumatra, but this difference was not statistically significant (O'Brien et al. 2003). Poaching pressure in Kerinci-Seblat National Park, Sumatra, among snared ungulates was greatest for muntjac as assessed by the diameter of the cable. Snaring is locally very high in the protected area, e.g. 51 snares (mostly of size suitable for muntjac) were found in 1 km² (Linkie et al. 2003), although it is much less intense than in areas of Indochina supporting the related M. vaginalis (J. Holden pers. comm. 2008). Data are too sparse to determine whether this hunting is driving declines. Habitat loss is also severe including within parts of the park (Linkie et al. 2003), and is an increasing phenomenon in Java (S. Hedges pers. comm. 2008).

Muntjacs are widely and heavily hunted on Borneo for meat, skins, and as a source of traditional remedies (Bennett et al. 2000; Mohd Azlan J. pers. comm. 2008; Belden Giman pers. comm. 2008; G.M. Fredriksson pers. comm. 2008; A.C. Sebastian pers. comm. 2008; Siew Te Wong pers. comm. 2008). Traditionally, hunting used traps, dogs and spears, and blowpipes. Hunters in remote parts of the interior still use these methods, but most animals now die by gunfire. Sarawak held 60,000 legally registered shotguns while Sabah held almost 13,000 in the mid 1990s (Bennett et al. 2000). Methods used in Indonesia include guns and spotlights along logging roads, snaring, and dogs (G.M. Fredriksson pers. comm. 2008; S. Hedges pers. comm. 2008). The combination of dogs and guns may be particularly efficient (Belden Giman pers. comm. 2008). Snaring is still very heavy outside well-secured areas, but shotguns remain the even bigger problem (Bennett et al. 2000; J. Mohd Azlan pers. comm. 2008; Siew Te Wong pers. comm. 2008). Unaccompanied packs of stray or even perhaps feral dogs are also likely to be a threat, particularly in forest isolates close to urban areas (e.g. Similajau National Park; J.W. Duckworth pers. comm. 2008). It is unlikely that hunters make any distinction between the two Bornean muntjac species directly, although it is plausible that M. muntjak is under lower hunting pressure than is M. atherodes reflecting its purported predominance in the hills and mountains (although there is little empirical evidence to support this), whereas most of the logging concessions currently lie in the lowlands. Some ethnic groups, at least the Punan, have traditional beliefs against eating muntjac meat (Belden Giman pers. comm. 2008), but over most of (at least) Malaysian Borneo, “in general, everyone will hunt and eat anything” (Bennett et al. 2000). Much hunting is for the market rather than local use, so there is a limitless demand. Bennett and Gumal (2001) profiled the hunting of ungulates in Sarawak in the mid 1990s thus: muntjacs (along with Bearded Hog Sus barbatus and Sambar Rusa unicolor) are heavily shot for wild meat trade across Sarawak, and these ungulates are the species most sought by the restaurants. Wild meat is widely sold in towns, villages, restaurants and logging camps throughout Sarawak; 250 sales outlets were estimated across the state in 1996, with an annual trade worth 3.75 million USD. Along the Rejang river alone, in the mid 1980s, 250 muntjacs were sold per year (Caldecott 1988). The market for meat is great and probably expanding. There were, then, no controls on commercial hunting of non-protected species (including muntjacs). The Master Plan for Wildlife in Sarawak (Wildlife Conservation Society and Sarawak Forest Department 1996) introduced a strict ban on all wildlife trade, shotgun ownership and cartridge sales in the late 1990s (Bennett and Gumal 2001). Substantial numbers of muntjacs are, nevertheless, still killed in the state, as they are elsewhere in Borneo.

Bennett et al. (2000) considered the effects of this onslaught upon muntjacs (not distinguished to species) through a lengthy hunting study in February 1993 to June 1995, in both Bornean states of Malaysia (Sarawak and Sabah), each with eight study areas. Muntjacs constituted only 3–10% of animals killed, but index counts of signs show an inverse relationship between sign index and hunting pressure so strong that the latter over-rode the effects of habitat variables in determining their densities. Hunting was so ubiquitous, even in protected areas, that in the two states, only one site (part of Danum Valley, Sabah) could be found as a control, where there was primary forest but negligible hunting levels. They concluded that “the only single factor offering any effective protection for [quarry species of] wildlife is difficulty of access”; whether animals are protected or non-protected species, inside or outside protected areas, had no significant restraint on hunting levels. In the interim, much forest has been lost and muntjac populations in the smaller and more isolated areas that remain must now be more vulnerable to local extinctions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Southern Red Muntjac is found in many protected areas throughout its range (GMA Indonesia Workshop). It is a protected game species in West Malaysia under the Wildlife Protection Act of 1972, meaning that it can be hunted only with a license and only outside protected areas (Kawanishi and Sunquist 2004). Indonesian forestry law protects all species of muntjac. Species protection laws relating to ungulates in many areas of Sumatra have not been widely publicized. A significant percentage of Sumatra’s forests are protected, but protected areas and the authorities responsible for conservation of catchment forests are often under-funded and almost all are grossly understaffed so that there is little ranger presence in the field. Where there are field ranger teams, these focus generally on flagship species such as Asian Elephant Elephas maximus, Sumatran Rhinoceros Dicerorhinus sumatrensis or Tiger Panthera tigris, although Tiger protection rangers do also conduct ungulate protection activities and in 2007 three hunters arrested in the national park with two muntjacs carcasses received custodial sentences at Kerinci district court (D. Martyr pers. comm. 2008). Much of Java’s remaining forest is officially protected. Heavy hunting with shotguns was found to be a severe problem for larger mammals and birds across Sarawak and the need for its control (of guns and of sale of ammunition, with firm legal underpinnings) was recognised in the Master Plan for Wildlife in Sarawak (Wildlife Conservation Society and Sarawak Forest Department 1996). As everywhere, people devise ways for circumventing the controls (illegal trade in bullets and locally made shot-guns, called bekakok, which have no administrative or legal paper-trail) and strong enforcement is required for the foreseeable future.

There seem to be no species-specific conservation measures in need of implementation, above turning existing laws on protected areas and protected wildlife into reality, with a particular focus on eradicating wildlife trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

In some areas, where the population is large, they destroy a large number of trees by tearing off the bark. This in turn can lead to a loss of food sources as well as a loss of wood that can be used to provide shelter.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Hunters of pheasants in India can rely on the barking noises made by the muntjac as a warning signal of an approaching predator. This could be a leopard or tiger which in turn can pose a threat to the hunters themselves. The muntjac itself can be hunted for its meat and skins.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Indian muntjac

The common muntjac (Muntiacus muntjak), also called the red muntjac,[2] Indian muntjac or Barking deer is the most numerous muntjac deer species. It has soft, short, brownish or greyish hair, sometimes with creamy markings. This species is omnivorous, feeding on fruits, shoots, seeds, birds' eggs as well as small animals and even carrion. It gives calls similar to barking, usually on sensing a predator (hence the common name for all muntjacs of barking deer).

The male Indian muntjac has small antlers which attain 15 cm in length and have only one branch. They grow annually from a bony stalk on the head. Males are extremely territorial and can be fierce for their size. They will fight each other for territory using their antlers or their (more dangerous) tusk-like upper canine teeth, and can defend themselves against predators such as dogs.

Contents

Introduction

The Indian muntjac (Muntiacus muntjak) is also commonly called the "barking deer" due to the bark-like sound that it makes as an alarm when danger is present. It is also called "Kakar". Sometimes these deer will bark for an hour or more. This species is one of eleven different species of muntjacs spread across Asia. The Indian muntjacs specifically are widespread throughout Southern Asia, but are one of the least known Asian animals. Paleontological evidence proves that Indian muntjacs have been around since the late Pleistocene epoch at least 12,000 years ago. Since then, they have played a major role in Southern Asia for sport hunting as well as being hunted for its meat and skin. Often, these animals are hunted around the outskirts of agricultural areas because they can be considered a nuisance damaging crops and ripping bark off of trees. However, this animal is still in an abundance in Southern Asia numbering anywhere from 140,000-150,000 in India alone as of 2004.

Description

The Indian muntjac has a short but very soft, thick, dense coat, especially those living in cooler regions. Coloration of the coat changes from dark brown to yellowish and grayish brown depending on the season. The muntjacs' coat is golden tan on the dorsal side and white on the ventral side of the body, the limbs are dark brown to reddish brown, and the face is dark brown. However, the ears have very little hair which barely covers them. Male muntjacs have antlers that are very short, about 1-2 inches, usually consisting of only two or three points at the most and protrude from long body hair covered pedicels on the forehead. Females have tufts of fur and small bony knobs where the antlers are located in males. Males also have slightly elongated upper canines about an inch long that curve slightly outward from the lips and have the capability to inflict serious injury upon other animals or to other members of the population while exhibiting aggression. Males are generally larger than females. The body length of muntjacs varies from 35-53 in wide and their height ranges from 15-26 in tall.

Habitat

The Indian muntjac is among the most widespread but least known of all the animals in South Asia. This species is distributed throughout South Asia, but more densely located in Southeastern Asia. Some specific countries the Indian muntjac is found in are Northeastern India, Bangladesh, Sri Lanka, Nepal, Islamabad Pakistan, Southern China, Vietnam, the Malay peninsula, Riau Archipelago, Sumatra, Bangka, Belitung Islands, Java, Bali, Cambodia, and Borneo. The muntjac is usually found in plentiful forests and places with dense vegetation such as grasslands, savannas, tropical deciduous forests, and tropical scrub forests. They are also very populated in the hilly country on the slopes of the Himalayas. They are found at both sea level and medium height altitudes up to 9,800 ft. They never wander far from water. Also, males usually have their own territory which may overlap the territories of a few females but not of another male.

Diet

The Indian muntjacs are classified as omnivores. They are considered both browsers and grazers with a diet consisting of grasses, ivy, prickly bushes, low growing leaves, bark, twigs, herbs, fruit, sprouts, seeds, tender shoots, bird eggs and small warm-blooded animals. Indian muntjacs are typically found feeding at the edge of the forest or in abandoned clearings. The muntjac’s found in the Nilgiri-Wayand area of south India are always sited in the large tea estates , as they feed mostly the tea seeds. Their large canine teeth help in the processes of retrieving and ingesting food.

Reproduction

The Indian muntjacs are polygamous animals. Females sexually mature during their first to second year of life. These females are polyestrous, with each cycle lasting about 14 to 21 days and an estrus lasting for 2 days. The gestation period is six to seven months and they usually bear one offspring at a time but sometimes produce twins. Females usually give birth in dense growth so that they are hidden from the rest of the herd and predators. The young leaves its mother after about six months to establish its own territory. Males often fight between one another for possession of a harem of females. Indian muntjacs are distinguished from other ungulates in showing no evidence of a specific breeding season within the species.

Behavior

Indian muntjacs are regarded as extremely solitary animals, rarely observed with other muntjacs, except for a mother and her young and during the rutting season. Males acquire territories that they mark with scent markers by rubbing their frontal preorbital gland (located on their head) on the ground and on trees, scraping their hooves against the ground, and scraping the bark of trees with their lower incisors. These scent markers allow other muntjacs to know whether a territory is occupied or not. Males will often fight with each other over these territories, sufficient vegetation, and for primary preference over females when mating using their short antlers and an even more dangerous weapon, their canines. If a male is not strong enough to acquire his own territory he will most likely become prey to a leopard or some other predator. During the time of the rut, territorial lines are temporarily disregarded and overlap while males roam constantly in search of a receptive female.

These deer are incredibly alert creatures. When put into a stressful situation or if a predator is sensed, muntjacs will begin making a bark-like sound. Barking was originally thought of as a means of communication between the deer during mating season as well as an alert. However, in more recent studies it has been identified as a mechanism used solely in alarming situations meant to cause a predator to realize that it has been detected and move elsewhere or to reveal itself. The barking mechanism is used more frequently when visibility is reduced and can last for over an hour regarding one incident.

Muntjacs exhibit both diurnality and nocturnality.

Subspecies

There are 15 subspecies:

Genetics

The female Indian muntjac deer is the mammal with the lowest recorded diploid number of chromosomes, where 2n = 6.[3] The male has a diploid number of 7 chromosomes. The similar Reeve's muntjac (Muntiacus reevesi), in comparison, has a diploid number of 46 chromosomes.[4]

Conservation status

Not threatened.

Pictures

References

  • Hutchins, Michael, ed. "Muntjacs." Grzimek's Animal Life Encyclopedia. 2nd ed. 15 vols. Detroit: The Gale Group Inc, 2004.
  • Kurt, Fred. "Muntjac Deer." Grzimek's Encyclopedia of Mammals. 1st ed. 5 vols. St. Louis: McGraw-Hill, 1990.
  • Nowak, Ronald M. "Muntjacs, or Barking Deer." Walker's Mammals of the World. 6th ed. 2 vols. Baltimore: The John Hopkins UP, 1999.
  1. ^ Timmins, R.J., Duckworth, J.W., Hedges, S., Pattanavibool, A., Steinmetz, R., Semiadi, G., Tyson, M. & Boeadi (2008). Muntiacus muntjak. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 5 April 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ Grubb, Peter (16 November 2005). "Muntiacus muntjak". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 667. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14200405. 
  3. ^ Kinnear, J. F. "Chromosomes: How Many?" Nature of Biology Third Edition. Book 2. Milton, Queensland: John Wiley & Sons Australia Ltd, 2006.
  4. ^ Doris H. Wurster and Kurt Benirschke: Indian Momtjac, Muntiacus muntiak: A Deer with a Low Diploid Chromosome Number. Science 12 June 1970: Vol. 168. no. 3937, pp. 1364 - 1366.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!