Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

Most of the information about the biology of the okapi is from captive animals (2). They are largely solitary (2) and though once thought to be nocturnal (6), are now known to be active during the day (2). They feed largely on leaves, grasses, fruits and fungi, some of which are known to be poisonous. It has been suggested that this is why okapis eat charcoal from burned forest trees, as is evidenced from their dung (2). Carbon, in the form of charcoal, is an excellent antidote for toxin ingestion and recent observations in Zanzibar found red colobus monkeys eating charcoal from native cooking fires and kilns (7). It is also known that many other animals find sources of kaolin, a type of clay, to offset the effects of poisonous leaves and fruit in their diet. Male and female okapi live in home ranges, but they are not territorial and these ranges overlap (3). From observations on captive animals, it appears that male okapis mark their ranges with urine, by crossing their front legs, urinating on them, and then walking through their range. They will also urinate directly onto plants. Both males and females rub their necks against tree trunks (3). Mothers will not stray very far after giving birth, so the young okapi will remain close by until at least a few days old, in what is known as a 'follower phase' (3). It then becomes a 'nester' for a number of months, in which it lies in vegetation. During this intensive nesting phase, the calf is extremely efficient in the use of energy, primarily only nursing or sleeping. Towards the end of the intensive nesting phase, the calf can maintain its temperature properly, and so activates its rumens, and defecates for the first time (3). This is thought to be a defence against predators (2). Okapi mothers use infrasonic communication to communicate with their calves. This is sound that is below the range of human hearing – also used by elephants (3). The young are weaned at six months old although they may continue to take milk for some time afterwards. The males begin developing their horns at about one year and reach their adult size at the age of three. They are believed to reach sexual maturity around two years old (2). Captive individuals have been known to live for up to 33 years (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Perhaps the most extraordinary fact about the okapi is that it was not known to science until 1901 (4). Its taxonomic name, Okapia johnstoni, honours both its native Central African name (5), and that of the man who first 'discovered' it, Sir Harry Johnston, the British explorer, naturalist and colonial administrator (4). The native pygmies of Central Africa had known of this animal's existence for generations, thinking it was a type of horse, which was how they described it to Sir Henry Morton Stanley (of 'Dr. Livingstone, I presume' fame) (4). In fact, the okapi is a forest-living relative of the giraffe (4). Although closely resembling a horse, the okapi has a relatively long neck although not as long as its giraffe cousins. The forehead, neck and body are brown, with light tan or grey on the animal's cheeks, throat and chest. Okapi hair is short, slightly oily to the touch and has a delicate scent (3). The hind limbs and upper forelegs have cross-stripes resembling those of a zebra whilst the lower limbs have white 'socks' with brown lines running up the front to the knees, where there is a brown band circling each leg (3). Males have short hair-covered, rearward-facing horns and both sexes have large mobile ears. Females are slightly taller than males (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Okapi distribution extends across parts of central, northern and eastern Democratic Republic of the Congo (DRC). North and east of the Congo River, Okapi range from Maiko Forest north to the Ituri Forest, then west through the Rubi, Tele and Ebola river basins, extending north towards the Ubangi River. Okapi have a much smaller range to the west and south of the Congo River, extending from the west bank of the Lomami River west to the upper Lomela and Tshuapa basins (Hart 2013). In the fairly recent past, Okapi occurred occasionally in the adjoining Semliki forest of western Uganda (Kingdon 1979).

The extent of occurrence (EOO) is 383,190 km2, but this includes unsuitable habitat such as degraded forest, swamp forest and urban areas. Excluding all these gives in an area of 244,405 km2 for the suitable or hypothesised range (Quinn et al. 2013). The area of occupancy (AOO) is 14,112 km2, based on a grid of 5.6 x 5.6 km, the size used by most reported surveys and 450 (3.5%) of 12,764 grid squares with confirmed presence Quinn et al. (2013). The AOO figure is, however, considered likely to be a substantial underestimate; surveys have been conducted in only 1,994 out of 12,764 grid squares so far.

Recorded presence is concentrated in and around protected areas, mainly reflecting survey effort. The remoteness and inaccessibility of much Okapi habitat make field work logistically difficult, and insecurity in DRC over the past two decades has further restricted survey activity. As a consequence, extensive parts of potential Okapi range are poorly studied. Furthermore, Okapi are secretive and their occurrence can easily go undetected, especially at low densities.

The known strongholds of the Okapi are the Ituri and Maiko Forests, the forests of the upper Lindi, Maiko and Tshopo basins and the Rubi-Tele region in Bas Uele (Hart 2013). There are confirmed recent (2013) records of Okapi in the Abumonbanzi Reserve in Gbadolite district of North Ubangi at the north-west end of the distribution.

Since 1980, expansion of human settlement, deforestation and forest degradation have eliminated important portions of Okapi range, in particular in the southern and eastern Ituri Forest where the species was at one time abundant (Hart 2013).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Okapis are found only in the tropical forests of northeastern Zaire. They prefer altitudes between 500 and 1,000 m, although they may venture above 1,000 m in the eastern montane rainforests. One sighting occurred at 1,450 m on Mt. Hoyo, in the upper Ituri. The range of the okapi is limited by high montane forests to the east, swamp forests below 500 m to the west, savannas of the Sahel/Soudan to the north, and open woodlands to the south. Okapis are most common in the Wamba and Epulu areas (Bodmer 1992).

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The okapi is found in the Democratic Republic of Congo and in the forested regions of Uganda (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The okapi has a form superficially resembling that of a horse. Average body length is 2.5 m, and average height at the shoulder is 1.5 m. The neck is relatively long in comparison to that of other ruminants, and the ears are large and flexible. The body is chocolate-brown, with creamy white horizontal stripes on the legs and hindquarters and white stockings on the ankles. The cheeks, throat, and chest are whitish-gray or tan (Bodmer 1992). The unique color pattern of the okapi allows it to disappear into the background of dense vegetation and rotting leaves where it lives (Grzimek 1990). Male okapis have hair-covered horns not exceeding 15 cm in length. The horns are fused to the frontal bones over the orbits and project rearward. Females may be slightly red in color, lack horns, and average 4.2 cm taller than males. Both males and females have interdigital glands on the front and hind feet (Bodmer 1992). The most giraffe-like feature of the okapi is the long black tongue which is used for plucking buds, leaves, and branches from trees and shrubs as well as for grooming (Kingdon 1979). In addition, the walking gait of the okapi closely resembles that of a giraffe. Both giraffe and okapi simultaneously step with the front and hind leg on the same side of the body rather than moving alternate legs on either side like other ungulates (Dagg, 1960).

Range mass: 200 to 300 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Body Length: 200-210 cm / 6.6-7 ft.
Shoulder Height: 150-170 cm / 5-5.6 ft.
Tail Length: 30-42 cm / 12-16.8 in.
Weight: 210-250 kg / 462-550 lb.
Public Domain

Supplier: Chanel Myers Myers

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Okapi are limited to closed, high canopy forests between about 500 m and 1,500 m in elevation and they occur in a wide range of primary and older secondary forest types. They do not extend into gallery forests or the forest-savanna ecotone and do not persist in disturbed habitats surrounding larger settlements. Okapi will use seasonally inundated areas when the substrate is still wet, but they do not occur in truly inundated sites or extensive swamp forest. Tree fall gaps are selected as foraging sites for Okapi during the early stages of regeneration (Hart 2013). Okapi are unique in being the only species of forest ungulate to depend on understorey foliage and they are known to feed on over 100 plant species. They are mainly diurnal but have also been recorded feeding at night (Nixon and Lusenge 2008). Okapi have defined but non-exclusive home ranges, averaging 3-5 km2 for adult females and up to 13 km2 for adult males. Okapi are mainly solitary (Hart 2013). Generation length is broadly estimated at around eight years, based on calculations made for the global captive population (S. Hofman and K. Leus 2013, unpubl. data).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Okapis occur in the dense rainforests at middle elevations within their range. They frequent river banks and stream beds and may occasionally venture into areas of secondary forest growth (Bodmer 1992).

Terrestrial Biomes: rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Okapis are forest animals, found in both dry and rain forest in tropical and sub-tropical latitudes (1) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Okapis are diurnal and forage along fixed, well-trodden paths through the forest (Grzimek 1990). They feed primarily on the leaves, buds, and shoots of more than 100 different species of forest vegetation (Bodmer 1992). Many of the plant species fed upon by the okapi are known to be poisonous to humans. Additionally, okapis eat grasses, fruits, ferns, and fungi. Examination of okapi feces has revealed that the charcoal from trees burnt by lightning is consumed as well. Field observations indicate that the okapi's mineral and salt requirements are filled primarily by a sulfurous, slightly salty, reddish clay found near rivers and streams (Grzimek 1990).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
30.0 years.

Average lifespan

Status: captivity:
15.0 years.

Average lifespan

Status: captivity:
33.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 33.5 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

In the wild, okapis are solitary, coming together primarily for mating. Okapi courtship and mating rituals are known only from observations done in zoos. Partners begin courtship by circling, sniffing, and licking eachother. Eventually, the male asserts his dominance by extending his neck, tossing his head, and thrusting one leg foreward. This display is followed by mounting and copulation. After mating, the male and female part (Grzimek 1990). The gestatation period lasts about 440 days (Bodmer 1992), and females retreat into dense forest vegetation to give birth (Grzimek 1990). Newborn okapis weigh 14-30 kg at birth. They are precocial and may nurse after 21 minutes and stand after just 30 minutes. Young spend the first day or two of life following the mother around and exploring the environment. After this, they find a suitable hiding spot and make a nest. For the next two months, they spend 80% of their time in this nest. Hiding behavior appears to promote rapid growth and provides protection from predators. A disturbed calf lies motionless in its nest, and a female okapi will rush to aggressively defend her calf from danger. During the hiding stage, young nurse relatively infrequently and do not defecate. These strategies help keep them undetected by predators. Weaning occcurrs at about 6 months, although young may continue to suckle for more than a year. Young males begin developing horns at one year of age, and both males and females reach adult size at about three years. In captivity, the youngest female to breed was 1 year 7 months old, and the youngest male was 2 years 2 months old. The okapi's lifespan is about 30 years in captivity, but data from wild populations is unavailable (Bodmer 1992).

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 16000 g.

Average gestation period: 458 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
790 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
578 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Okapia johnstoni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGATTATTTTCAACTAACCACAAAGACATTGGCACCTTATACCTACTATTCGGCGCTTGAGCCGGTATAGTGGGGACAGCCCTGAGCCTATTGATTCGTGCTGAGCTAGGCCAACCTGGAACCTTACTCGGAGATGACCAAATTTACAATGTAGTCGTAACCGCCCACGCATTCGTAATAATCTTCTTTATAGTAATACCAATTATGATCGGGGGTTTCGGTAACTGACTCGTCCCCCTAATAATTGGTGCCCCTGACATAGCCTTCCCCCGAATAAATAATATAAGTTTCTGACTTCTTCCCCCTTCATTTCTACTGCTTCTAGCATCATCCATGGTAGAAGCCGGAGCAGGAACCGGCTGAACCGTATATCCCCCATTGGCAGGCAACCTGGCCCACGCAGGAGCCTCAGTTGATTTAACTATTTTTTCTCTACACCTAGCAGGTGTCTCCTCAATCCTAGGGGCCATCAATTTTATTACAACAATCATCAATATGAAACCCCCTGCAATATCACAGTACCAAACCCCCTTATTCGTGTGATCCGTAATAATTACTGCCGTACTACTTCTCCTCTCGCTCCCTGTATTAGCAGCTGGAATTACAATACTATTAACAGACCGAAACCTAAATACGACATTTTTTGACCCAGCAGGAGGGGGGGACCCTATTCTGTACCAACACCTGTTTTGATTCTTCGGACACCCAGAGGTATATATTCTTATTTTGCCTGGGTTCGGAATAATCTCCCATATTGTGACCTATTACTCAGGAAAAAAAGAACCATTTGGATATATGGGCATGGTCTGAGCCATAATATCAATCGGATTCCTGGGCTTTATTGTATGAGCTCACCATATGTTCACAGTTGGAATAGACGTTGACACACGAGCTTACTTTACATCGGCTACCATAATCATTGCCATTCCCACTGGAGTAAAAGTCTTTAGCTGACTAGCAACACTCCACGGGGGCAATATTAAATGATCCCCCGCTTTAATATGAGCTCTGGGCTTCATCTTTCTTTTTACAGTAGGAGGCCTAACCGGAATTGTCCTAGCCAACTCCTCCCTTGACATTGTTCTCCACGACACATACTATGTAGTAGCACACTTCCACTACGTACTGTCAATAGGAGCTGTATTTGCCATTATAGGCGGATTCGTCCATTGATTTCCTCTATTCTCAGGTTACACCCTTAACACCACATGAACTAAAATCCACTTTGCAATTATATTTGTAGGTGTAAACATGACCTTCTTCCCACAACACTTCCTAGGATTATCCGGTATACCACGACGCTACTCTGACTATCCAGACGCATATACAATGTGAAATACCATCTCATCTATGGGCTCATTTATCTCCCTAACAGCAGTCATACTAATAGTTTTCATTATCTGAGAAGCATTCGCATCTAAACGAGAAGTCCTAGCTGTGGACCTAACTACAACAAATCTAGAGTGGTTAAACGGATGTCCTCCACCATACCACACATTCGAAGAACCCACATATATTAACTCAAAGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Okapia johnstoni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2abcd+4abcd

Version
3.1

Year Assessed
2013

Assessor/s
Mallon, D., Kümpel, N., Quinn, A., Shurter, S., Lukas, J., Hart, J. & Mapilanga, J.

Reviewer/s
Hoffmann, M.

Contributor/s

Justification

Okapi have been undergoing a decline since at least 1995 that is ongoing and projected to continue, in the face of severe, intensifying threats and lack of effective conservation action. The rate of decline is estimated to have exceeded 50% over three generations (24 years), between 1995 and 2013 and suspected to continue for the next few years given sustained pressures in its range. The estimate is based on figures from surveys in the Okapi Wildlife Reserve (Réserve de Faune à Okapis; RFO) showing a 43% decline 1995-2007 and a further 47% decline 2008-2012, in addition to reported declines or extirpations in other parts of the range and loss and degradation of habitat that is ongoing since 1980. This suggests the species also exceeds the 50% threshold for Endangered based on an estimated decline three generations into the past. The RFO has until recently been the best protected site and it is inferred that the rate of decline here is at least equalled in other parts of the range. The change in category between 2008 (Near Threatened) and present is non-genuine as the new information suggests that the current categorization of Endangered also should have applied in 2008.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

The okapi was not recognized by western scientists until 1900, when Harry Johnston sent two pecies of "zebra-like" skin to London (Kingdon 1979). More recently, the okapi has been extirpated from Uganda and, since 1933, protected by law in Zaire. Despite its patchy distribution, the okapi is common in much of its current range and is therefore not listed as a threatened species by international agreement. However, habitat loss due to deforestation as well as poaching continue to restrict the range of the species and take their toll on the population. Another great danger to the okapi is lack of knowledge about it outside of zoos. Little field research has been done on the species due to its inaccessible habitat and reclusive nature (Bodmer 1992).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk - near threatened (LR/nt) on the IUCN Red List 2003 (1)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
East (1999) estimated that the total population may be over 10,000 and Hart (2013) estimated 35,000-50,000. Current numbers are believed to be much lower and declining, but there is no reliable estimate of current population size. The most robust recent population estimates were made in the Okapi Wildlife Reserve (Réserve de Faune à Okapis; RFO) in 1993-1995 and repeated in 2005-2007 using the same Distance sampling methodology (Hart et al. 2008). These surveys produced estimates of 4,428 (95% CI 2,947-6,653) and 2,507 (1,622-3,871) in the two survey periods, respectively, a 43% decrease.

A second set of figures for RFO is available from Law Enforcement Monitoring (LEM) patrol data (RFO/ICCN unpubl. data). These showed a 47% decrease in Okapi sign encounter rates between 2008 and 2012, and over 60% decline in direct observations. The methodology used does not allow confidence intervals to be calculated, but the patrol routes covered extensive distances ranging from 10,125 to 25,467 km annually.

In the Twabinga-Mundo region, anecdotal evidence suggests that Okapi are targeted for their skins and meat, and have undergone a drastic decline in numbers over the past two decades with local people reporting that Okapi is the most prized bushmeat available (Nixon 2010). Okapi had been present south of the town of Aketi and near the town of Buta but no signs were found on recent field surveys and locals said they had recently been hunted out by Bangalema nomadic hunters (Hicks 2010).

RFO was until recently the most effectively protected Okapi site with resident rangers and an active conservation programme and the overall rate of decline here is inferred to have been equalled or exceeded elsewhere.


Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Okapi can coexist with small-scale, low-level human occupation of the forest, but disappear in areas of active settlement or disturbance, and the major threat to this species is habitat loss due to logging and human settlement including illegal occupation of protected areas (Hart 2013, Quinn et al. 2013).

According to Hart (2013) approximately one-third of the Okapi’s known distribution is likely to be at risk by major incursions during the first quarter of this century. Areas at high risk include the south-eastern Ituri Forest, the Kisangani area, Rubi-Tele, and the western and eastern limits of the species' range in the Ebola River basin and Virunga-Hoyo region respectively.

Hunting for meat and skins is also a threat and Okapi decline rapidly in areas where there is persistent use of snares. In some areas, Okapi are targeted for bushmeat whereas in others they are taken only incidentally (Hart 2013, Quinn et al. 2013).

The most prominent current threat to Okapi is the presence of illegal armed groups in and around key protected areas. These groups prevent effective conservation action, even surveys and monitoring in most sites, and engage in and facilitate elephant poaching, bushmeat hunting, illegal mining (gold, coltan and diamonds), illegal logging, charcoal production and agricultural encroachment. In a notorious incident in June 2012, armed rebels attacked the RFO HQ and killed seven people and all 14 captive Okapi.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The main threat to the okapi is loss of its habitat to agriculture and encroaching human settlements. Hunting is also a problem in some regions (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Okapi is not included in the CITES Appendices. The Okapi is a fully protected species under Congolese law and the species is a national symbol, appearing on the insignia of the Institut Congolais pour la Conservation de la Nature (ICCN) and on Congolese banknotes.

The RFO (14,000 km2) and Maiko National Park (10,800 km2) support significant populations, but numbers in both sites have declined owing to the threats listed above. Strengthening protection of these two protected areas is the single most important means to ensure long-term survival of Okapi (East 1999, Hart 2013). A small population of Okapi still occurs in the Watalinga Forest (1,100 km2 ) in the northern sector of Virunga National Park, but currently receives no protection due to the presence of armed groups. They have also been recorded in Mt Hoyo Reserve (200 km2). Okapi occur in Rubi-Tele Hunting Reserve (ca. 9,000 km2) though its precise legal status is unclear, and in Abumombanzi Reserve. A proposed national park within the Tshuapa-Lomami-Lualaba landscape covering 9,500 km2 is undergoing the process of official gazettement (Quinn et al. 2013). A number of community reserves are located around Maiko National Park.

Many captive Okapi are held in international collections. In November 2011, representatives of the North American and European captive populations, including the Okapi Species Survival Plan (SSP) and the Okapi European Endangered Species Programme (EEP), met to discuss the role of the captive population in Okapi conservation and agreed to maintain a sustainable, cooperatively managed global ex situ Okapi population that contributes to a viable in situ population (Petric 2012). The zoo community is a major supporter of Okapi conservation work, in 2010 donating USD 225,000 to the Okapi Conservation Project, 33% of its budget (Gilman International Conservation 2010).

The Institut Congolais pour la Conservation de la Nature (ICCN) is the government agency responsible for protected area management but is under-staffed and under-funded. The Okapi Conservation Project was established in 1987 and works within the RFO to protect Okapi and their habitat, as well as the culture of the indigenous Mbuti pygmies. Project activities include capacity building, agroforestry and community support (Gilman International Conservation, 2010). Several international NGOs also work or have recently conducted Okapi-related work in DRC, including Fauna & Flora International, Frankfurt Zoological Society, Wildlife Conservation Society, the Lukuru Foundation, and the Zoological Society of London (ZSL). The first-ever species-wide Okapi conservation strategy is currently being finalized following its development at a workshop held in DRC in May 2013 that was organised by ZSL in partnership with ICCN (Quinn et al. 2013). In March 2013 a new IUCN SSC Giraffe and Okapi Specialist Group was established, with the aim of coordinating research and conservation on both giraffid species and supporting implementation of the Okapi conservation strategy.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The okapi is classified as Lower Risk - near threatened by the World Conservation Union (IUCN) Red List of Threatened Species. Its populations are thought to be stable at the present time (1). However, with increased deforestation to provide agricultural areas to feed an increasing human population within the animal's range, more studies of the wild okapi may be needed to accurately assess its conservation requirements (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Immediately following their discovery in 1900, zoos around the world attempted to obtain okapis from the wild. These initial attempts were accompanied by a high mortality rate due to the rigors of traveling thousands of miles by boat and by train. In more recent years, shipment by airplane has proven more successful. Today, many zoos keep and breed okapis, and many people visit these zoos each year to see them (Grzimek 1990).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Okapi

This article is about the animal. For other uses, see Okapi (disambiguation).

The okapi /ˈkɑːp/ (Okapia johnstoni), also known as the forest giraffe or zebra giraffe[citation needed], is a giraffid artiodactyl mammal native to the Ituri Rainforest[citation needed], located in the northeast of the Democratic Republic of the Congo in Central Africa. Although the okapi bears striped markings reminiscent of zebras, it is most closely related to the giraffe. The okapi and the giraffe are the only living members of the family Giraffidae.[2]

The animal was brought to prominent European attention by speculation on its existence found in popular press reports covering Henry Morton Stanley's journeys in 1887. Remains of a carcass were later sent to London by the English adventurer and colonial administrator Harry Johnston and became a media event in 1901.[3] A 2013 study determined there are 10,000 okapis remaining in the wild, down from 40,000 a decade ago. The same year, the okapi was reclassified as an endangered species.[4]

Etymology[edit]

The generic name Okapia derives from the Lese Karo name o'api,[citation needed] while the specific name (johnstoni) is in recognition of the British Governor of Uganda, Harry Johnston, who first acquired an okapi specimen for science from the Ituri Forest while repatriating a group of Pygmies to the Belgian Congo.[citation needed]

Characteristics and behavior[edit]

Okapis have reddish dark backs, with striking horizontal white stripes on the front and back legs, making them resemble zebras from a distance. These markings possibly help young follow their mothers through the dense rain forest and may also serve as camouflage.[5][6]

The body shape is similar to that of the giraffe, except okapis have much shorter necks. Like the giraffe, the okapi has long legs and a robust body. Both species have very long (about 35-cm),[7] flexible tongues used to strip leaves and buds from trees.

An okapi cleaning its muzzle with its tongue

The okapi's tongue is also long enough for the animal to wash its eyelids and clean its ears (inside and out). This sticky tongue is pointed and bluish-grey in colour like that of the giraffe. Male okapis have short, skin-covered horns called ossicones. Their large ears help them detect their predator, the leopard.[citation needed]

Okapis are 1.9 to 2.5 m (6.2 to 8.2 ft) long (from the head to the base of the tail) and stand 1.5 to 2.0 m (4.9 to 6.6 ft) high at the shoulder. They have 30- to 42-cm-long tails. Their weight ranges from 200 to 350 kg (440 to 770 lb).[8]

Okapis are primarily diurnal, although recent photo captures have challenged this long-held assumption. One photograph of an okapi feeding in the Watalinga Forest of Virunga National Park, was taken at half-past two in the early morning, thus demonstrating that they also feed at night.[citation needed] Okapis are essentially solitary, coming together only to breed, with the exception of mothers and offspring. Breeding behaviours include sniffing, circling, and licking each other.[9]

Okapis forage along fixed, well-trodden paths through the forest. They have overlapping home ranges of several square kilometers and typically occur at densities of about 0.6 animals per km2 (about 1.5 animals per mi2). They are not social animals, and prefer to live in large, secluded areas. This has led to problems with the okapi population due to the shrinking size of their habitats. This lack of territory is caused by human land development and other limiting social factors.

Okapis have several methods of communicating their territory, including scent glands on each foot that produce a tar-like substance, as well as urine marking. The male is protective of his territory, but allows females to pass through the domain to forage.

A number of okapis in zoos exhibit monosomy, a condition in which one copy of a chromosome is missing. Some okapis have 46 chromosomes while others have 45. This type of monosomy is often referred to as Robertsonian fusion. Okapis with 45 or 46 chromosomes produce healthy viable offspring.[10]

Habitat[edit]

Okapis prefer altitudes of 500 to 1,000 m, but may venture above 1,000 m in the eastern montane rainforests. Because of a considerable amount of rain in these forests, okapis have oily, velvety fur coats that repel the water.[11]

The okapi's range is limited by high montane forests to the east, swamps to the southeast, swamp forests below 500 m to the west, savannas of the Sahel/Sudan to the north, and open woodlands to the south. They are most commonly found in the Wamba and Epulu areas.

Diet[edit]

Okapis are herbivores, feeding on tree leaves and buds, grasses, ferns, fruits, and fungi. Many of the plant species on which okapis feed are poisonous to humans.

Examination of okapi feces has revealed they consume charcoal from trees burnt by lightning. Field observations indicate their mineral and salt requirements are filled primarily by a sulfurous, slightly salty, reddish clay found near rivers and streams.

History[edit]

Although the okapi was unknown to the Western world until the 20th century, it may have been depicted since the early fifth century BCE on the façade of the Apadana at Persepolis, a gift from the Ethiopian procession to the Achaemenid kingdom.[12]

An okapi stands next to its calf at White Oak Conservation.

For years, Europeans in Africa had heard of an animal that they came to call the 'African unicorn'. In his travelogue of exploring the Congo, Henry Morton Stanley mentioned a kind of donkey that the natives called the atti, which scholars later identified as the okapi. Explorers may have seen the fleeting view of the striped backside as the animal fled through the bushes, leading to speculation that the okapi was some sort of rainforest zebra.

When the British governor of Uganda, Sir Harry Johnston, discovered some pygmy inhabitants of the Congo being abducted by a showman for exhibition, he rescued them and promised to return them to their homes. The grateful pygmies fed Johnston's curiosity about the animal mentioned in Stanley's book. Johnston was puzzled by the okapi tracks the natives showed him; while he had expected to be on the trail of some sort of forest-dwelling horse, the tracks were of a cloven-hoofed beast.

Though Johnston did not see an okapi himself, he did manage to obtain pieces of striped skin and eventually a skull. From this skull, the okapi was correctly classified as a relative of the giraffe; in 1901, the species was formally recognized as Okapia johnstoni.[13]

The okapi is sometimes referred to as an example of a living fossil.[14]

In captivity[edit]

An okapi at Bristol Zoo cleans itself.
Okapi at Zoo Miami.

The first okapi to arrive in Europe was in 1918 to Antwerp Zoo. In 1937, the first okapi arrived in North America to the Bronx Zoo.[citation needed] The first okapi birth in captivity occurred at the Stanleyville Zoo in the Belgian Congo on April 19, 1941.[15][better source needed] In 1928, the American anthropologist Patrick Putnam founded the capture station known as "Epulu" in the Belgian Congo, where okapis were captured for shipment to zoos.[citation needed] Today this is the Okapi Breeding and Research Station, located in Okapi Wildlife Reserve in the northeastern part of the Democratic Republic of Congo.

As of 2014, 176 okapis live in zoos. The majority of them, 94, are in the United States. There is also 69 in Europe, seven in Japan, four in United Arab Emirates, and two in the South Africa.[16][17] The Brookfield Zoo directs the Okapi Species Survival Plan (SSP) for the Association of Zoos and Aquariums.[citation needed] The European Endangered Species Programme (EEP) for the okapi is led by the Antwerp Zoo which also keeps the International Okapi Studbook.[citation needed] The zoos which participate in the Okapi SSP and EEP, as well as other zoos, are important sources of funding for the Okapi Conservation Project aimed at conserving the okapi in the wild.[18]

Wild status[edit]

Okapis are classified as endangered since 2013; they are endangered by habitat destruction and poaching. The world population is estimated at 10,000. Conservation work in the Democratic Republic of the Congo by the Okapi Conservation Project includes the continuing study of okapi behaviour and lifestyle, which led to the creation in 1992 of the Okapi Wildlife Reserve. The Congo Civil War threatened both the wildlife and the conservation workers in the reserve.

An important captive-breeding centre at Epulu, at the heart of the reserve, is managed jointly by the Congolese Institute for Nature Conservation (ICCN) and Gilman International Conservation,[19] which in turn receives support from other organisations including UNESCO, the Frankfurt Zoological Society and WildlifeDirect[20] as well as from zoos around the world. The Wildlife Conservation Society is also active in the Okapi Wildlife Reserve.

On 8 June 2006, scientists reported evidence of surviving okapis in Congo's Virunga National Park. This had been the first official okapi sighting in that park since 1959, after nearly half a century.[21] In September 2008, the Wildlife Conservation Society reported one of their camera traps in Virunga National Park had snapped the first photo ever taken of an okapi in the wild.[22]

See also[edit]

References[edit]

  1. ^ IUCN SSC Antelope Specialist Group (2008). Okapia johnstoni. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 26 November 2013. Database entry includes a brief justification of why this species is endangered.
  2. ^ Kingdon, et al (2013). Mammals of Africa. A&C Black, 2013. p. 96. ISBN 9781408189962. 
  3. ^ Shaw, Albert (1918). "The African okapi, a beast unknown to the zoos". The American review of reviews 57: 544. 
  4. ^ Hebert, Amanda (26 November 2013). "Okapi Added to IUCN’S Endangered Species List". Jacksonville, Florida: Okapi Conservation Project. Retrieved 3 June 2014. 
  5. ^ "San Diego Zoo's Animal Bytes: Okapi". Sandiegozoo.org. Retrieved 13 July 2010. 
  6. ^ "Okapi". Zsl.org. 
  7. ^ "Okapi" from Bristol Zoo Gardens. Retrieved 24 September 2010.
  8. ^ Burnie D and Wilson DE (Eds.), Animal: The Definitive Visual Guide to the World's Wildlife. DK Adult (2005), ISBN 0789477645
  9. ^ Animal Diversity Web: ''Okapia johnstoni'' – okapi. Animaldiversity.ummz.umich.edu. Retrieved on 2013-11-26.
  10. ^ The Okapi Mysterious Animal of Congo-Zaire, Susan Lyndaker Lindsey, Mary Neel Green & Cynthia L. Bennett, University of Texas Press 1999
  11. ^ San Diego Zoo's Animal Bytes: Okapi. Sandiegozoo.org (2011-09-04). Retrieved on 2013-11-26.
  12. ^ The Oriental Institute of the University of Chicago, Photographic Archives; photo detail. The Oriental Institute identifies the subject as an Okapi with a question mark.
  13. ^ Nowak, Ronald M (1999) Walker's Mammals of the World. 6th ed. p. 1085.
  14. ^ "Why Is the Okapi Called a Living Fossil". The Milwaukee Journal. 24 June 1954. 
  15. ^ The International Okapi Studbook[full citation needed]
  16. ^ Okapi Studbook The Okapi, Management Site http://theokapi.org/welcome.aspx[full citation needed]
  17. ^ The Okapi Management Website http://theokapi.org/welcome.aspx[full citation needed]
  18. ^ The Okapi Conservation Project http://okapiconservation.org/about/partners/
  19. ^ GIC. Giconline.org. Retrieved on 2013-11-26.
  20. ^ "WildlifeDirect Saving Endangered Animals". 
  21. ^ Poston, Lee (8 June 2006) Rare Okapi Sighted in Eastern Congo Park. World Wild Life.
  22. ^ Photo Reveals Rare Okapi Survives Poaching Onslaught, Newswise, 10 September 2008. Many mainstream media outlets incorrectly reported that it was the first time an okapi had ever been photographed anywhere in the wild.

Further reading[edit]

  • Wolfram Bell (Nov. 2009): "Okapis – geheimnisvolle Urwaldgiraffen. Entdeckungsgeschichte, Biologie, Haltung und Medizin einer seltenen Tierart." Schüling Verlag Münster, Germany. ISBN 978-3-86523-144-4.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!