Overview

Brief Summary

Biology

The giraffe is non-territorial and sociable, forming loose herds with no permanent members in very variable home ranges of between 5 and 650 km² (3). Females tend to associate most with one another when they have young, as the calves tend to play together in crèches (3). Males leave their mothers at around three years, and sometimes form roaming bachelor herds that look for females (cows) in heat (3). Males spar with each other at all ages, standing side by side and swinging their necks to thump their head into the other male's body. These fights can be quite gentle, or quite fierce, sometimes resulting in knocked-out giraffes (2). Mating occurs year-round, peaking in the rainy season, and results in pregnancies lasting 15 months. Females will usually become pregnant for the first time in their fourth year (3). The single calf begins life with a two metre drop, as females give birth standing up (7). The newborn calf is able to stand within 20 minutes and will grow about 2.1 m in its first year. At a year old, young giraffes have been weaned but remain close to them until at least 22 months old, often remaining nearby for life (3). Despite the females' attempts to stand over their calves during attacks by lions, spotted hyenas, leopards and African wild dogs (6), many calves are killed in their first few months (3). Sexual maturity occurs at three to four years in both males and females, but males rarely have the opportunity to mate before seven years old (3). Life expectancy in the wild is 20 years (6). Using its 45 cm prehensile, black tongue, the giraffe rips the thorny leaves from Acacia and Combretum trees and may eat as many as 100 other plant species (3). Reaching higher than any other mammal, the giraffe can eat up to 134 kg of leaves a day, and can ruminate whilst walking (3). These enormous animals do not migrate as they can obtain most of the moisture they need from their diet, but they will drink every two to three days when water is available. It is possible to distinguish the sexes from a distance as males more often extend their heads in line with their necks to reach branches higher than those the females are feeding from, with bent necks (4). With strong eyesight from an elevated position and a good sense of smell, giraffes are often accompanied by zebra and wildebeest which may benefit from the giraffe as an 'early warning system' (8). Whilst it was thought that giraffes did not make any sounds, this is now known to be untrue, as giraffes bellow, snort, hiss and make flute-like sounds, as well as low pitch noises beyond the range of human hearing (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Spectacularly tall, the giraffe has a very long neck with a short, upstanding mane, and high shoulders that slope steeply to the hindquarters. The legs are also long. The giraffe's neck is made up of the same number of neck bones (vertebrae) as most mammals, including humans, but they are much larger and linked by ball and socket joints for improved flexibility (4). The specific name of the giraffe comes from the Latin 'camelopardalis', meaning 'camel marked like a leopard', owing to their buff background with brown blotches, which helps to camouflage them in the dappled light and shade patterns created by the trees they feed on (5). The various subspecies of giraffe differ slightly in colouration and patterning. The reticulated giraffe of northeastern Kenya (Giraffa camelopardalis reticulata) has large, chestnut-coloured patches outlined by thin white lines. Rothschild's giraffe of western Kenya and eastern Uganda (Giraffa camelopardalis rothschildi) has broader dividing white lines than the reticulated giraffe, and no spotting beneath the knees. The Masai giraffe of Tanzania and southern Kenya (Giraffa camelopardalis tippelskirchi) has irregular star-shaped light to dark brown spots. Giraffes have two horn-like structures about 13 cm long made of skin-covered bone; they are thin and tufted in females and thick and bald on top in males, as a result of wearing during fights with other males (3). Males can develop calcium depositions on their heads in addition to their horns as they age. These help to deliver heavier blows during fights with other males (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Range Description

The Giraffe formerly occurred in arid and dry-savanna zones of sub-Saharan Africa, wherever trees occur. Today, its range has contracted markedly with the expansion of human populations, especially in West Africa.

In West Africa, Giraffe formerly ranged from Senegal to Lake Chad, but the only viable surviving population within this entire area is a small population in south-western Niger with a range of about 15,000 km² (Boulet et al. 2004). This represents the only surviving wild population of G. c. peralta; a small population observed in the Ansongo-Menaka Partial Faunal Reserve in Mali, on the border of Niger, is presumed to be extinct.

Giraffe are still present in northern Cameroon, southern Chad, Central African Republic and in Garamba National Park in north-eastern Democratic Republic of Congo (East 1999); there is limited information on their occurrence in Sudan, west of the Nile (where they were not recorded at all during the course of recent surveys), but they do still occur in the south-east (in Boma National Park) (Fay et al. 2007). In East and north-east Africa, Giraffe still occur in relatively large numbers in northern Kenya, mainly outside protected areas, in south-western and southern Ethiopia, Somalia, and in small numbers in a few protected areas in Uganda; they are now extinct in Eritrea. Giraffe remain relatively widely distributed through southern Kenya and Tanzania. Of some concern is the status of Rothschild’s Giraffe, for which the only remaining naturally occurring population occurs in Murchison Falls National Park, Uganda. Rothschild's Giraffes have been re-introduced to six sites in Kenya (Ruma National Park; Mt Elgon National Park; Murgor Farm, Iten; Sergoit-Kruger Farm, Iten; Kitale Area Farm; Nasalot Reserve) and one site in Uganda (Kidepo Valley National Park) within the native range. Six extralimital introductions have also taken place in Kenya.

There is an isolated population of Giraffe (Thornicroft’s Giraffe G. c. thornicrofti) in the Luangwa Valley (Zambia).

In southern Africa, having been reintroduced to many parts of the range from which they were eliminated, Giraffes are currently common both inside and outside a number of protected areas in Namibia, Botswana, Zimbabwe and South Africa. In Angola, the Giraffe is now assumed to be extinct. A few animals are reported to still survive in Sioma Ngwezi National Park in south-western Zambia, while in Mozambique, a few individuals still occur in the area adjacent to Kruger National Park. Giraffe have been introduced to Swaziland (Giraffe Conservation foundation pers. obs., J. Fennessy pers. obs., Ciofolo and Pendu in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Giraffa camelopardalis is native to Africa, mainly found south of the Sahara to eastern Transvaal, Natal, and northern Botswana. Giraffes have disappeared from most of western Africa, except a residual population in Niger. They have been reintroduced in South Africa to game reserves.

Biogeographic Regions: ethiopian (Native )

  • 2003. Grzimek's Animal Life Encyclopedia. Pp. 399-408 in M Hutchins, D Kleiman, V Geist, M McDade, eds. Okapis and giraffes, Vol. 15: IV, 2 Edition. Farmington Hills, MI: Gale Group.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The giraffe is found south of the Sahara in Africa (4), but has been eliminated from most of western Africa and the southern Kalahari (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Giraffa camelopardalis is the world’s tallest mammal. Male giraffes (bulls) stand a total of 5.7 m from the ground to their horns: 3.3 m at the shoulders with a long neck of 2.4 m. Female giraffes (cows) are 0.7 to 1 m shorter than bulls. Bulls weigh up to 1,930 kg, while cows can weigh up to 1,180 kg. At birth, giraffe calves are 2 m tall from the ground to the shoulders. Newborn giraffes weigh 50 to 55 kg.

Both male and female giraffes have a spotted coat. The pattern of the coat varies and is an aide for camouflage with the different habitats. The nine giraffe subspecies have various skin patterns. The patches on a giraffe coat can be small, medium, or large in size. Giraffe coats are sharp-edged or fuzzy-edged; small, medium, or large; or yellow to black in color. The skin pattern for an individual giraffe is constant throughout the giraffe’s life. With the changing of season and health, the coat color may be altered.

Giraffa camelopardalis have long, sturdy legs, with their front legs longer than their back legs. Giraffe necks contain 7 elongated vertebrae. Giraffes have a steeply sloping back from the shoulders to the rump. Their tails are thin and long, measuring about 76 to 101 cm in length. A black tuft at the end of the tail whisks away flies and other flying insects. Giraffe horns, called ossicones, are bone protuberances covered with skin and fur. Female giraffe horns are thin and tufted; male giraffe horns are thick but the hair is smoothed by sparring. A medium-sized horn is common in both male and females; while males can grow a second pair behind the first pair of horns. The eyes are very large and their 45 cm long black tongue grasps prickly food from the very tops of trees.

Range mass: 1180 to 1930 kg.

Range length: 4.7 to 5.7 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Typically associated with Acacia, Commiphora and Combretum savannas, but they also occur marginally in miombo Brachystegia woodland and in Isoberlina woodland, in Cameroon (Ciofolo and Pendu in press). Giraffes are selective browsers, with Acacia species forming the bulk of their diet throughout the range, but also species of the genera Balanites, Commiphora, Detarium, Boscia, Combretum, Ziziphus and Grewia (Ciofolo and Pendu in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Giraffes inhabits arid, dry land. They seek out areas enriched with Acacia growth. Giraffes are found in savannas, grasslands, or open woodlands. Because they only occasionally drink, giraffes can be found away from a water source. Male giraffes can venture into denser wooded areas in search of more foliage.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; scrub forest

  • 1999. Walker's Mammals of the World. Pp. 1084-1089 in R Nowak, ed. Okapi and Giraffe, Vol. 2, 6 Edition. Baltimore, Maryland: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Inhabits savanna, scrub, open acacia woodlands and subtropical and tropical grasslands with trees and bushes (1) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Giraffes feed on leaves, flowers, seed pods, and fruits. In areas where the savanna floor is salty or full of minerals, they eat soil as well. Giraffes are ruminants and have a four-chambered stomach. Chewing cud while traveling helps to maximize their feeding opportunities.

Giraffa camelopardalis have long tongues, narrow muzzles, and flexible upper lips to help obtain leaves from the tall trees they use for browsing. Giraffes use many tree species for browse, including: Acacia senegal, Mimosa pudica, Combretum micranthum, and Prunus armeniaca. Their main food is the leaves from Acacia trees. Giraffes browse by taking the branches in their mouths and pulling away the head to tear away the leaves. Acacia trees have thorns but giraffe molars crush the thorns. Up to 66 kg of food for one day can be consumed by an adult, male giraffe. However, in poor-quality areas, a giraffe can survive on 7 kg of food per day.

Male giraffes typically feed with their head and neck completely outstretched to the shoots. Their fodder is from the underside of the high canopy. Female giraffes feed at body and knee height, feeding from the crown of lower trees or shrubs. Female giraffes are more selective when feeding. They choose foliage with highest nutritional value.

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Giraffes are host to troublesome ticks. Oxpecker birds (Buphagus africanus) rests on the backs and necks of giraffes, removing the ticks from the giraffe skin. There is a mutually beneficial relationship between giraffes and oxpecker birds.

Mutualist Species:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Lions (Panthera leo) are the main predators of giraffes; while leopards (Panthera pardus) and (hyenas Hyaena hyaena) have also been known to prey on giraffes. Adult giraffes are well able to defend themselves. They remain vigilant and are capable of running quickly and delivering deadly blows with their front hooves. Crocodiles may also prey on giraffes when they come to waterholes to drink. Most predators of giraffes target young, sick, or elderly giraffes. The blotchy color of giraffe skin also helps to camouflage them while foraging in scrub forests.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Giraffa camelopardalis are rarely heard and are usually considered silent mammals. Giraffes communicate with one another by infrasonic sound. They do, at times, vocalize to one another by grunts or whistle-like cries. Some other communication sounds for giraffes are moaning, snoring, hissing, and flutelike sounds. When alarmed, a giraffe grunts or snorts to warn neighboring giraffes of the danger. Mother giraffes can whistle to their young calves. Also, cows search for their lost young by making bellowing calls. The calves return their mother’s calls by bleating or mewing. While courting an estrous cow, male giraffes may cough raucously.

Giraffe vision relies mainly on their height. Their height allows giraffes a continual visual contact while at great distances from their herd. The acute eyesight of giraffes can spot predators at a distance so they can prepare to defend themselves by kicking. Individuals within a herd may scatter widely across the grassland in search of good food or drink, and only cluster together at good food trees or if threatened.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: duets

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Giraffa camelopardalis have a life expectancy between 20 to 27 years in zoos. Giraffes live for 10 to 15 years in the wild.

Range lifespan

Status: wild:
25 (high) years.

Range lifespan

Status: captivity:
27 (high) years.

Typical lifespan

Status: wild:
10 to 15 years.

Typical lifespan

Status: captivity:
20 to 25 years.

Average lifespan

Status: captivity:
25 years.

  • 2005. "Animal Fact Sheet" (On-line). Reticulated Giraffe. Accessed November 19, 2005 at http://www.zoo.org/educate/fact_sheets/savana/giraffe.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 39.5 years (captivity) Observations: There are anecdotal reports of giraffes living over 40 years. One wild born specimen was about 39.5 years when it died in captivity (Richard Weigl 2005). Tooth wear has been suggested to have a significant deleterious impact in captivity (Clauss et al. 2007).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Giraffes are polgynous. Bulls carefully guard an estrous female from other male giraffes. Courtship starts when a bull approaches a cow to perform a urine test, smelling the urine with a pronounced lip curl, a behavior referred to as flehmen. The bull will then proceed to rub his head near the rump of the female and rest it on her back. Male giraffes lick the tail of the female and lift his foreleg. If receptive, the female giraffe will circle the male, hold her tail out, and take on a mating position, after which copulation occurs.

Mating System: polygynous

For Giraffa camelopardalis, conception occurs in the rainy season, with birth occurring in the dry months. Most giraffe births take place from May to August. Female giraffes breed every 20 to 30 months. The gestation period is about 457 days. Mother giraffes give birth standing up or walking. The giraffe calf drops 2 m to the ground. Most often a single calf is born; twins are uncommon but do occur. Newborn calves get to their feet and begin suckling fifteen minutes after birth. The weaning period for female calves is 12 to 16 months; the weaning period for males is 12 to 14 months. The independence period varies between bulls and cows. Cows tend to stay within the herd. However, bulls tend to become solitary until they find or obtain their own herd and become the dominant male. Female giraffes reach sexual maturity at 3 to 4 years of age but do not breed for at least another year. At age 4 to 5 years, male giraffe become sexually mature; however, it is not until seven years of age when they start to breed.

Breeding interval: Giraffes can give birth every 20 to 30 months

Breeding season: Breeding occurs between May and August.

Range number of offspring: 1 (low) .

Range gestation period: 400 to 468 days.

Average gestation period: 457 days.

Range weaning age: 12 to 16 months.

Average weaning age: 12 months.

Range time to independence: 1 to 3 years.

Range age at sexual or reproductive maturity (female): 3 to 4 years.

Range age at sexual or reproductive maturity (male): 4 to 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 58500 g.

Average number of offspring: 1.

A giraffe calf hides throughout much of the day and night of its first week, remaining on the ground. Mother giraffes stay nearby, within 25 m, guarding their young and feeding. At night females return to their young to nurse them.

After three to four weeks, mother giraffes steer their young calves into crèche groups. The crèche group allows mother giraffes to wander further away from the young calf to feed or drink. The mother giraffes take turns watching over all the youngsters in the crèche group. Now the mother giraffe can drift as far as 200 m from her calf. Mothers still return before nightfall to suckle and protect their calf.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • 1997. Encyclopedia of Mammals. Pp. 809-833 in A Brown, et. al., eds. Browsing Giants, Vol. 6. Tarrytown, New York: Marshall Cavendish Corp..
  • 2003. Grzimek's Animal Life Encyclopedia. Pp. 399-408 in M Hutchins, D Kleiman, V Geist, M McDade, eds. Okapis and giraffes, Vol. 15: IV, 2 Edition. Farmington Hills, MI: Gale Group.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Tongue protected from thorns: giraffe
 

The tongues and mouths of giraffes and other ungulates are protected when eating thorny plants because they are leathery.

     
  "Yet giraffe and camels and goats have developed tongues that are so long, mobile and dexterous that they can select and grasp any particular shoot that they want, and the linings to their mouths seem to be so leathery that they can close around the thorns without damage of any kind." (Attenborough 1995:61)
  Learn more about this functional adaptation.
  • Attenborough, D. 1995. The Private Life of Plants: A Natural History of Plant Behavior. London: BBC Books. 320 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Pressure assists blood circulation: giraffe
 

Tight skin of giraffe legs assists blood circulation by creating extravascular pressure.

     
  "Its [giraffe's] heart is two-and-a-half times as big as zoologists would expect for an animal of its size. And the skin around its legs is unusually tight. Pedley [Tim Pedley of the University of Cambridge] says that high blood pressure would encourage blood to pool in a giraffe's legs. The tight skin acts like a support stocking, forcing blood back up into the body." (Thomas 1997:24)
  Learn more about this functional adaptation.
  • Thomas, Jim. 1997. A heart for heights. New Scientist. (2100): 24.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Secretions repel insects, bacteria: giraffe
 

The skin and hair of giraffes may repel ticks, mosquitoes and bacteria via secreted chemical compounds, particularly indole, skatole, and p-cresol.

     
  "…two alkaloids, indole and 3-methylindole (skatole), are primarily responsible for the scent of the giraffe…Indole occurs naturally in the floral scent of jasmine, orange blossom and other flowers (Poucher, 1974). Indole and 3-methylindole have an intense faecal odour at high concentrations that becomes pleasant in very dilute solutions — both are used in perfumery (Poucher, 1974)…Many of these compounds may function as antimicrobial agents…The growth of two ubiquitous species of skin bacteria is inhibited by some of the giraffe-derived compounds…Another possible function of these compounds may be to repel ectoparasitic arthropods. Both indole and skatole were judged by Rudolfs (1922, 1930) to repel wildcaught mosquitoes (Aedes spp.) from the US, but quantitative results are needed to affirm this. A tick found in areas inhabited by giraffes, Rhipicephalus appendiculatus, is repelled by p-cresol, one of the giraffe skin compounds…" (Wood and Weldon 2003:915-916)
  Learn more about this functional adaptation.
  • Wood, W. F.; Weldon, P. J. 2002. The scent of the reticulated giraffe (Giraffa camelopardalis reticulata). Biochemical Systematics and Ecology. 30(10): 913-917.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Giraffa camelopardalis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2253-09|NC_012100|Giraffa camelopardalis| AACCGCTGATTATTTTCAACCAACCACAAAGACATTGGCACCTTATACTTACTATTCGGCGCTTGAGCCGGTATAGTAGGAACAGCCCTA---AGCTTACTGATTCGTGCTGAACTGGGCCAACCCGGGACCTTGCTCGGAGAC---GATCAGATTTATAACGTAGTCGTAACTGCCCATGCATTTGTAATAATTTTCTTCATAGTAATACCAATTATGATTGGGGGATTTGGTAATTGACTCGTCCCTCTGATA---ATTGGTGCTCCCGACATAGCTTTTCCCCGAATAAATAATATAAGCTTCTGACTTCTCCCCCCTTCATTCCTATTACTCCTAGCATCATCTATAGTAGAGGCCGGAGCAGGAACAGGCTGAACTGTATATCCCCCACTAGCCGGCAACCTAGCCCATGCAGGAGCCTCAGTAGACCTA---ACTATCTTTTCTCTACATTTAGCAGGTGTCTCCTCAATTCTAGGGGCCATTAATTTTATTACAACAATCATCAATATGAAACCCCCTGCAGTATCACAATACCAAACACCTCTGTTCGTATGATCCGTACTAGTTACTGCCGTACTACTTCTTCTCTCACTCCCTGTACTGGCAGCT---GGAATTACTATACTACTGACAGACCGAAATCTAAACACAACATTTTTTGACCCTGCAGGAGGAGGGGATCCAGTCCTATACCAACATCTATTCTGATTTTTTGGACACCCAGAAGTGTATATTCTTATTCTACCTGGATTTGGAATAATCTCACACATTGTAACCTACTACTCAGGAAAGAAA---GAACCGTTCGGATACATAGGAATGGTCTGAGCCATGATATCAATTGGATTTTTGGGCTTCATTGTATGAGCTCACCATATGTTCACAGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Giraffa camelopardalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Fennessy, J. & Brown, D.

Reviewer/s
Hoffmann, M. & Mallon, D.

Contributor/s

Justification
Provisionally listed as Least Concern as the species remains widespread, with a total population numbering more than 100,000 individuals. However, a recent preliminary population estimate suggests a decline in the total population has taken place which, if substantiated, could mean that the species will warrant listing in a higher category of threat. Some populations remain stable or are even increasing, but others are clearly in a more precarious position (and may well be threatened). Ongoing efforts to census the continent's giraffe populations will allow more accurate assessment of the species' overall conservation status, as well as described subspecies in future.

History
  • 1996
    Lower Risk/conservation dependent
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Giraffa camelopardalis populations seem to be stable throughout parts of their range and are threatened in other areas. Giraffes are hunted and poached for their skin, meat, and tail. Habitat destruction also impacts giraffe populations. Giraffe populations remain common in east and southern Africa but have drastically fallen in west Africa. In Niger, conservation of giraffes has been made a priority. In other places where large mammals have disappeared, giraffes have survived. Their survival could be because their height diminishes competition with domestic mammals.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The giraffe is classified as Least Concern (LC) on the IUCN Red List (1). Subspecies: Niger giraffe Giraffa camelopardalis peralta is classified as Endangered on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
East (1999) estimated the total population at about 140,000 animals, predominantly in areas dominated by Acacia woodlands and shrublands. More recent preliminary estimates put the total population at less than 80,000 animals ( International Giraffe Working Group and Giraffe Conservation Foundation pers. comm.); efforts are currently under way to census the continent’s populations more accurately (Fennessy 2007) which will enable a more thorough determination of the conservation status of the species and subspecies.

The population in Niger estimated to number 79 animals in 1999 (Ciofolo et al. 2000), has since increased to more than 200 animals in 2007 ( J Suraud pers. obs.).

In 1998 there was an estimated population of more than 500 Rothschild’s (and Nubian) giraffe, with the populations from Sudan unknown (East 1999). There were an estimated 2,500 individuals in Murchison Falls National Park in the 1960s, declining sharply to 350 in 1982–1983 and 250 in 1995–1996. The current population in Murchison Falls National Park is estimated to be of 240 individuals and stable. The reintroduced population in Ruma National Park, Kenya, is estimated to be of 130 individuals and is declining due to poaching. Numbers at each of the other five reintroduction sites are of 10-20 individuals and some of these are unlikely to be viable. In sum, Rothschild’s Giraffe is estimated to number less than 470 individuals in Uganda and Kenya, with an unknown (but likely small) number in southern Sudan.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
While southern populations are increasing in abundance, northern populations have been decreasing due to habitat degradation and poaching. For example, poaching and armed conflict across the range of the Reticulated Giraffe in Somalia, Ethiopia and Kenya has reduced numbers to perhaps fewer than 5,000 individuals ( Giraffe Conservation Foundation pers. obs., Fennessy 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Giraffes were previously killed for their tails alone, which were used as fly swats, good luck charms and thread for sewing (9). Now, the main threats to the giraffe are habitat loss and poaching for meat and hides (4) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
East (1999) estimated that around 40% of the total population survived in and around protected areas, with the main strongholds including: Waza National Park and the hunting zones of North Province (Cameroon); Zakouma National Park (Chad); Murchison Falls National Park (Uganda); Boma National Park (Sudan); South Luangwa National Park (Zambia); and, in southern Africa, Etosha National Park (Namibia), Hwange National Park (Zimbabwe) and Kruger National Park (South Africa) (East 1999; Ciofolo and Pendu in press). Some of the major protected populations have decreased during the 1990s in national parks such as Serengeti (Tanzania) and Tsavo (Kenya).

In Niger, conservation projects have facilitated the Niger Giraffe’s population recovery in an area outside any formal protected park or reserve. However, poaching and habitat loss and degradation as a result of increased aridity, and expansion of human activities remain threats (Ciofolo and Pendu in press). This small population survives only in the wild, since the Giraffes held in captivity in the Vincennes Zoo, France, which were long considered to represent peralta, in fact belong to the subspecies antiquorum (Hassanin et al. 2007).

Rothschild's Giraffe is one of the most imperilled Giraffe subspecies remaining. Exact numbers of giraffes in MurchisonFallsNational Park are approximate due to lack of surveys but are most recently estimated at approximately 240 individuals. Determining exact population numbers and conservation status of the Murchison Falls National Park Rothschild's Giraffe population is a priority for long-term conservation of this subspecies. Wildlife Conservation Society are planning a survey in 2010.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Giraffes are protected where they occur in National Parks and private game parks, and whilst they are also protected by hunting laws, poaching still occurs (4). The giraffe is involved in a Species Survival Program for captive individuals in American zoos, which includes the education of the public in conservation matters as well as cooperation with other conservation agencies (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of giraffes on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In many zoos and wildlife parks, giraffes serve as an attraction. Giraffes have been killed for their meat and hide. The thick skin has been made into buckets, reins, whips, straps for harnesses, and sometime for musical instruments.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Giraffe

Camelopard redirects here.

The giraffe (Giraffa camelopardalis) is an African even-toed ungulate mammal, the tallest of all extant land-living animal species, and the largest ruminant. Its scientific name, which is similar to its archaic English name of camelopard, refers to its irregular patches of color on a light background, which bear a token resemblance to a leopard's spots. The average mass for an adult male giraffe is 1,200 kilograms (2,600 lb) while the average mass for an adult female is 830 kilograms (1,800 lb).[3][4] It is approximately 4.3 metres (14 ft) to 5.2 metres (17 ft) tall, although the tallest male recorded stood almost 6 metres (20 ft).[3][4]

The giraffe is related to other even-toed ungulates, such as deer and cattle, but is placed in a separate family, the Giraffidae, consisting of only the giraffe and its closest relative, the okapi, and their extinct relatives. Its range extends from Chad in Central Africa to South Africa. Giraffes usually inhabit savannas, grasslands, or open woodlands. However, when food is scarce they will venture into areas with denser vegetation. They prefer areas with plenty of acacia growth. They will drink large quantities of water when available, which enables them to live for extended periods in arid areas. The giraffe's fur may serve as a chemical defence, and is full of antibiotics and parasite repellents that gives the animal a characteristic scent. Old males are sometimes nicknamed "stink bulls". There are at least eleven main aromatic chemicals in the fur, although indole and 3-methylindole are responsible for most of their smell. Because the males have a stronger odour than the females, it is also suspected that it has a sexual function.[5] The giraffe has one of the shortest sleep requirements of any mammal, which averages 4.6 hours per 24 hours.[6][7]

Contents

Etymology

The name giraffe has its earliest known origins in the Arabic word الزرافة ziraafa or zurapha, perhaps from an African name. It appears in English from the 16th century on, often in the Italianate form giraffa. The species name camelopardalis (camelopard) is derived from its early Roman name, where it was described as having characteristics of both a camel and a leopard.[8] The English word camelopard first appeared in the 14th century and survived in common usage well into the 19th century. The Afrikaans language retained it.

Taxonomy and evolution

Comparison of the African Miocene giraffids: Palaeotragus (two top) and Climacoceras (two bottom)

The giraffe is one of only two living species of the family Giraffidae, along with the okapi. The family was once much more extensive, with over 10 fossil genera described. The giraffids evolved from a 3 m (9.8 ft) tall antelope-like mammal that roamed Europe and Asia some 30–50 million years ago.[9] The earliest known giraffid was Climacoceras, which still resembled deer, having large antler-like ossicones. It first appeared in the early Miocene epoch. Later examples include the genera Palaeotragus and Samotherium, which appeared in the early-to-mid-Miocene. They were both tall at the shoulder, and had developed the simple, unbranched ossicones of modern giraffids, but still had relatively short necks.[10] From the late Pliocene onwards, the variety of giraffids drastically declined, until only the two surviving species remained. The modern genus Giraffa evolved during the Pliocene epoch, and included a number of other long-necked species, such as Giraffa jumae, that do not survive today.[10]

The giraffe was one of the many species first described by Linnaeus in 1758. He gave it the binomial name of Cervus camelopardalis in the 10th edition of his Systema Naturae.[11] Brisson erected the genus Giraffa in 1762.

Subspecies

Different authorities recognize different numbers of subspecies, differentiated by size, colour and pattern variations and range.[1][2][12] Some of these subspecies may prove to be separate species[2] as they appear to be reproductively isolated despite their mobility.[13] The subspecies recognized by most recent authorities are:

  • G. c. camelopardalis,[14] the nominate subspecies, is known as the Nubian Giraffe. Its coat pattern has large, four-sided spots of chestnut brown on an off-white background and no spots on inner sides of the legs or below the hocks. It is found in eastern Sudan and northeastern DR Congo. It has been estimated that fewer than 250 remain in the wild, but little is known about this subspecies and consequently this estimate is labelled with great uncertainty.[15] It is very rare in captivity, although kept at Al Ain Zoo in the United Arab Emirates.[16]
  • G. c. reticulata,[14] known as the Reticulated[14] or Somali Giraffe, has a coat pattern of well defined patches that are normally a bright orange-brown colour.[17] These patches have sharp edges and are separated by bold, bright white lines.[17] It ranges from northeastern Kenya, into southern Ethiopia and Somalia. It has been estimated that fewer than 5.000 remain in the wild,[15] and based on ISIS records it is among the most common in zoos, with more than 450 kept.[18]
  • G. c. angolensis, the Angolan or Smoky Giraffe, has large spots with some notches around the edges, extending down the entire lower leg. It is found in southern Angola, northern Namibia, southwestern Zambia, Botswana and western Zimbabwe. It has been estimated that fewer than 20,000 remain in the wild,[15] and based on ISIS records approximately 20 are kept in zoos.[18]
  • G. c. antiquorum,[14] the Kordofan Giraffe, has smaller, more irregular spots that cover the inner legs. Its distribution includes southern Chad, Central African Republic and northern Cameroon. Populations in Cameroon were formerly included in G. c. peralta instead, but this was incorrect.[19] Fewer than 3,000 are believed to remain in the wild.[15] Considerable confusion has existed over the status of this subspecies and G. c. peralta in zoos. In 2007 it was shown that all "G. c. peralta" in European zoos actually are G. c. antiquorum.[19] Consequently, approximately 65 are kept in zoos based on ISIS records.[18]
  • G. c. tippelskirchi,[14] known as the Maasai Giraffe[14] or Kilimanjaro Giraffe, has jagged-edged, vine-leaf shaped spots of dark brown on a brownish-cream background.[17] It is the darkest coloured subspecies.[17] It occurs in central and southern Kenya and Tanzania. It is estimated that fewer than 40,000 remain in the wild,[15] and based on ISIS records approximately 100 are kept in zoos.[18]
  • G. c. rothschildi,[14] is known variously as the Rothschild Giraffe[14] or Baringo Giraffe or Ugandan Giraffe. Its coats bears deep brown, blotched or rectangular spots with poorly defined cream lines. Its legs are mostly white with no pattern.[17] Its range includes Uganda and west-central Kenya, especially near Lake Baringo. It may also occur in southern Sudan.[20] Fewer than 700 are believed to remain in the wild,[15] and based on ISIS records more than 450 are kept in zoos.[18]
  • G. c. giraffa, the South African Giraffe, has rounded or blotched spots, some with star-like extensions on a light tan background, running down to the hooves. It is found in northern South Africa, southern Botswana, southern Zimbabwe and southwestern Mozambique. It is estimated that fewer than 12,000 remain in the wild,[15] and based on ISIS records approximately 45 are kept in zoos.[18]
  • G. c. thornicrofti,[14] called the Thornicroft Giraffe[14] or Rhodesian Giraffe, has star-shaped or leafy spots extend to the lower leg. It is restricted to the Luangwa Valley in eastern Zambia. Fewer than 1,500 remain in the wild,[15] and based on ISIS records none are kept in zoos.[18]
  • G. c. peralta,[14] commonly known as the West African Giraffe[14] or Nigerian Giraffe, has numerous pale, yellowish red spots. It is endemic to southern Niger. With fewer than 220 individuals remaining in the wild, it is the rarest giraffe subspecies.[15] Giraffes in Cameroon were formerly believed to be this subspecies, but are actually G. c. antiquorum.[19] This has also resulted in some confusion over its status in zoos, but in 2007 it was established that all "G. c. peralta" kept in European zoos actually are G. c. antiquorum.[19]

Formerly, the Kordofan and West African Giraffes were regarded as a single subspecies, but genetic evidence has confirmed that they represent two separate subspecies.[19] Comparably, the Rothschild's Giraffe has been considered a hybrid population,[12] but genetic evidence has confirmed that it is a valid subspecies.[21] By contrast, scientists have proposed four other subspecies — Cape Giraffe (G. c. capensis), Lado Giraffe (G. c. cottoni), Congo Giraffe (G. c. congoensis), and Transvaal Giraffe (G. c. wardi) — but today none of these is widely accepted.[1] One genetic study on Smoky Giraffes suggests that the northern Namib Desert and Etosha National Park populations are distinct subspecies.[22]

Although giraffes of these populations interbreed freely under conditions of captivity, suggesting that they are subspecific populations, genetic testing published in 2007 has been interpreted to show that there may be at least six species of giraffe that are reproductively isolated and not interbreeding, even though no natural obstacles, like mountain ranges or impassable rivers block their mutual access. The study found that the two giraffe populations that live closest to each other— the reticulated giraffe (G. camelopardalis reticulata) of north Kenya, and the Masai giraffe (G. c. tippelskirchi) in south Kenya— separated genetically between 0.13 and 1.62 million years ago, judging from genetic drift in nuclear and mitochondrial DNA.[21]

The implications for conservation of as many as eleven such cryptic species and subspecies were summarised by David Brown for BBC News: "Lumping all giraffes into one species obscures the reality that some kinds of giraffe are on the brink. Some of these populations number only a few hundred individuals and need immediate protection."[23]

Anatomy and morphology

Giraffe skeleton on display by The Museum of Osteology, Oklahoma City, Oklahoma.

Male giraffes are up to 5.5 metres (18 ft) tall at the horn tips, and weigh between 800 and 1,930 kilograms (1,800 and 4,300 lb). Females are between 4 and 4.5 metres (13 and 14.8 ft) tall and weigh between 550 and 1,180 kilograms (1,200 and 2,600 lb). The coat is made up of brown blotches or patches separated by lighter hair. Each giraffe has a unique coat pattern.[24]

Horns

Both sexes have prominent horns, formed from ossified cartilage, and known as ossicones. The appearance of horns is a reliable method of identifying the sex of giraffes, with the females displaying tufts of hair on the top of the horns, whereas males' horns are larger and tend to be bald on top — the hairs worn away due to necking in combat. Males sometimes develop calcium deposits which form bumps on their skull as they age, which can give the appearance of up to three additional horns.[25]

Legs and locomotion

Giraffes also have slightly elongated forelegs, about 10% longer than their hind legs, and can reach a sprint speed of up to 60 km/h (37 mph).[26] It cannot sustain a lengthy chase. The apparent inflexibility of its legs give it a stiff gait when walking.[27] When running the giraffe thrusts its front legs into the air and when they touch the ground they push off again.[28] When the hind legs land together the process starts over.[28] The giraffe is briefly airborne when running.[28] When hunting adult giraffes, lions try to knock the lanky animal off its feet and pull it down.[29] Giraffes are difficult and dangerous prey. The giraffe defends itself with a powerful kick. A single well-placed kick from an adult giraffe can kill a predator.[27] Lions are the only predators which pose a serious threat to an adult giraffe.[30]

Swimming

Although no definitive study has been publicly conducted, giraffes are assumed to be unable to swim. It has been estimated that the giraffe's proportionally larger limbs have very high rotational inertias making rapid swimming motions strenuous.[31] A swimming giraffe – forced into a posture where the neck is sub-horizontal and with a thorax that is pulled downwards by the large fore limbs – would not be able to move the neck and limbs synchronously as giraffes do when moving on land, possibly further hampering the animal's ability to move its limbs effectively underwater.[31]

A computer simulation conducted by Scientific American suggested that while a giraffe could float, "they would be clumsy and unstable in water".[32] The simulation suggests the giraffe's high density in its limb bones would make it slow and suffer from high drag.[32] Furthermore, the weight of the forelimbs and shoulder would pull the front of the giraffe down, straining its neck.[32]

Neck

An adult male giraffe feeding high up on an acacia.

The giraffe's extreme altitude is a consequence of its extremely elongated neck, which can be over 2 m (7 ft) in length,[33] accounting for nearly half of the giraffe's vertical height. The increase in neck length results from the disproportionate elongation of the cervical vertebrae, rather than the addition of more vertebrae. The cervical vertebrae comprise about 45–50% of the giraffe vertebral column, compared to the 30% typical of similar large ungulates, including the giraffe’s closest extant relative, the okapi. This elongation, which occurs in large part after birth,[34] is a 150% increase in vertebrae length over similar sized animals – in fact, the non-cervical sections of the giraffe vertebral column exhibit identical proportions to those in okapi.

In addition to their elongated cervical vertebrae, in giraffes the point of articulation between the cervical and thoracic vertebrae is shifted to lie between T1 and T2, the first and second thoracic vertebrae, rather than between C7 and T1, as in most other ruminants.[33][34] This allows C7 to contribute directly to increased neck length, and has sparked the suggestion that T1 is actually C8, and giraffes have added an extra cervical vertebra.[35] However, this proposition is generally not accepted, as T1 has other morphological features, such as an articulating rib, deemed diagnostic of thoracic vertebrae. Also, the exceptions to the mammalian constraint of seven cervical vertebrae are generally characterized by increased neurological anomalies and maladies, symptoms that have not been observed in giraffes.[33]

There are two main hypotheses regarding the evolutionary origin and maintenance of elongation in giraffe necks.[36] The “competing browsers hypothesis” was originally suggested by Charles Darwin and only challenged recently. It suggests that competitive pressure from smaller browsers, such as kudu, steenbok, and impala, drove the elongation of the neck so giraffes could reach nutrients competitors could not. This advantage is real – giraffes can and do feed up to 5 m, while most of their competitors, kudu, can only feed up to about 2 m (7 ft).[37] There is also research suggesting that browsing competition below 2 m is intense, and giraffes feed more efficiently (gaining more leaf biomass per bite) higher in the canopy.[38][39] However, scientists disagree about just how much time giraffes spend feeding at levels unreachable to other browsers.[36][37][40] Although giraffes can feed as low as 0.5 m and as high as 6 m off the ground, it appears that they most often feed between 2 and 4 m (7–14 ft).[40] However, elephants also routinely feed at heights up to 5 m (they knock down only a minority of the trees they feed on), and are likely competitors at these heights. Competition for food with other giraffes could also favor the evolution of tall necks.

The other main theory, the sexual selection hypothesis, proposes that the long necks evolved as a secondary sexual characteristic, giving males an advantage in "necking" contests (see below) to establish dominance and obtain access to sexually receptive females.[41] In support of this theory, males have proportionally larger necks than females,[36][41] and males with longer, bigger necks are more successful in dominance displays and courtship behavior.[42] However, a major criticism of this theory is that it fails to adequately explain why female giraffes also have long necks.[43]

Bending down to drink is more strenuous for a giraffe than for other ungulates.

Circulatory system

Modifications to the giraffe's structure have evolved, particularly to the circulatory system. A giraffe's heart, which can weigh up to 10 kg (22 lb)[27] and measure about 60 cm (2 ft) long, must generate approximately double the normal blood pressure for an average large mammal to maintain blood flow to the brain.[27] In the upper neck, a complex pressure-regulation system called the rete mirabile prevents excess blood flow to the brain when the giraffe lowers its head to drink.[27]

The jugular veins also contain several (most commonly seven) valves to minimise blood flowing back into the head and assist it getting to the inferior vena cava and right atrium in the same situation.[44] Conversely, the blood vessels in the lower legs are under great pressure (because of the weight of fluid pressing down on them). In other animals such pressure would force the blood out through the capillary walls; giraffes, however, have a very tight sheath of thick skin over their lower limbs which maintains high extravascular pressure in the same way as a pilot's g-suit.[14]

Lifestyle

Social structure and breeding habits

Giraffes normally gather around a food source.
Male giraffe mounting a female. Only dominant males will be able to mate.

While giraffes are usually found in groups, the composition of these groups is more fluid than in other social ungulates.[45] They are a largely transient species with few strong social bonds and aggregations usually disband every few hours, although calving groups can last weeks to months.[46] For research purposes, a "group" has been defined as "a collection of individuals that are less than a kilometre apart and moving in the same general direction."[47] Giraffe groups can range from over 40 individuals to only a few individuals with the latter being more common.[48] Female giraffes associate in groups of a dozen or so members, occasionally including a few younger males. Calves and sub-adults are rarely alone.[47][49] Giraffe groups with young tend to feed in more open areas, presumably to provide better visibility to detect predators. This may reduce their feeding efficiency.[40]

Reproduction is broadly polygamous, with a few older males impregnating the fertile females. Male giraffes determine female fertility by tasting the female's urine in order to detect estrus, in a multi-step process known as the Flehmen response.[46][47] Once a estrous female is detected, the male will them attempt to court her.[47][49] Males prefer younger females, possibly became the latter are more fertile,[46][47][49] while females prefer older, more dominant males.[46][47][49] During courtship, dominant males will displace subordinates from the presence of the females, by staring and walking towards them. Thus the female prolongs the courtship process for as long as possible so only the most dominant male remains and copulation will follow.

Although generally quiet and non-vocal, giraffes have been heard to communicate with various sounds. Courting males will emit loud coughs.[30] Females will call their young by whistling or bellowing. Calves will bleat, moo, or make mewing sounds. In addition, giraffes will grunt, snort, hiss, or make strange flute-like sounds. Recent research has provided evidence that the giraffes produce infrasound.[50]

Two young, Maasai Giraffes, Serengeti National Parkm Tanzania. About 1 week old. One in background still has umbilical cord.

Birthing, parental care, and lifespan

Giraffe gestation lasts between 400 and 460 days, after which a single calf is normally born, although twins occasionally occur.[51] The mother gives birth standing up and the embryonic sack usually bursts when the baby falls to the ground. Newborn giraffes are about 1.8 m (5 ft. 11 in.) tall.

Within a few hours of being born, calves can run around and are indistinguishable from a week-old calf; however, for the first two weeks, they spend most of their time lying down, guarded by the mother.[46][52] It has been speculated that their characteristic spotted pattern provides a certain degree of camouflage. Mothers with calves will gather in nursery herds which are usually made up of two or more infants and/or juveniles and their mothers moving or browsing together.[52] Mothers in a groups may sometimes leave their calves with one female while they travelled to other areas. It is what’s known as a "calving pool".[52] Males largely play no role in raising the young.

The young can fall prey to lions, leopards, spotted hyenas, and wild dogs. Mother giraffes will defend their young by placing themselves between the young and the predator and kicking the predator.[49] Giraffes only defend their own young and form calving herds for selfish reasons.[52] Only 25 to 50% of giraffe calves reach adulthood. Maximum lifespan is ~25 years in the wild[14] and 28 years in captivity.[53]

Necking

Male giraffes will engage in necking for various reasons, notably combat.

Male giraffes often engage in necking, which has been described as having various functions. One of these is combat. Battles can be fatal, but are more often less severe, generally ending when one giraffe surrenders to the other. The longer the neck, and the heavier the head at the end of the neck, the greater the force a giraffe is able to deliver in a blow. It has also been observed that males that are successful in necking have greater access to estrous females, so the length of the neck may be a product of sexual selection.[54]

After a necking duel, a giraffe can land a powerful blow with his head — occasionally knocking a male opponent to the ground. These fights rarely last more than a few minutes or end in physical harm.

Another function of necking is sexual, in which two males caress and court each other, leading up to mounting and climax. Such interactions between males are more frequent than heterosexual coupling.[55] In one study, up to 94% of observed mounting incidents took place between two males. The proportion of same sex activities varied between 30 and 75%, and at any given time one in twenty males were engaged in non-combative necking behaviour with another male. Only 1% of same-sex mounting incidents occurred between females.[56]

Diet

Giraffe extending its tongue to feed. Its tongue, lips and palate are tough enough to deal with sharp thorns in trees.

Giraffes browse on the twigs of trees, preferring trees of the genera Acacia, Commiphora and Terminalia, and also eat grass and fruit.[12][57] The tongue, lips and palate are tough, which allows them to feed on trees with sharp thorns. In Southern Africa, giraffes feed on all acacias, especially Acacia erioloba. A giraffe can eat 65 pounds (29 kg) of leaves and twigs daily, but can survive on just 15 pounds (6.8 kg).[57]

The giraffe requires less food than typical grazing animals because the foliage it eats has more concentrated nutrition and it has a more efficient digestive system.[12] During the wet season, food is abundant and giraffes disperse widely, but during the dry season they need to congragate around evergreen trees and bushes.[12] As a ruminant, it first chews its food, then swallows for processing and then visibly regurgitates the semi-digested cud up their necks and back into the mouth, in order to chew again. This process is usually repeated several times for each mouthful. The giraffe can survive without water for extended periods.[57] Compared with domestic cattle, giraffes have a comparatively short small intestine and a comparatively long large intestine, with a resulting small ratio of small:large intestine.[58] A giraffe can clean off bugs (like acacia ants) on its face with its extremely long tongue (about 45 centimetres (18 in)).

Stereotypic behavior

Many animals when kept in captivity, such as in zoos, display abnormal behaviours. Such unnatural behaviours are known as stereotypic behaviours.[59] In particular, giraffes show distinct patterns of stereotypic behaviours when removed from their natural environment. Due to a subconscious response to suckle milk from their mother, something which many human-reared giraffes and other captive animals do not experience, giraffes resort instead to excessive tongue use on inanimate objects.[60]

Human interactions

In art and culture

The giraffe was considered the "queen of beasts" by Arab prophets and poet for what they considered to be its delicate features and fragile form.[61] Eastern sultans prized them as special pets.[61] Giraffes were also known to the people of the Mediterranean region during antiquity.[61] Pompey apparently kept ten at his theater in Rome.[61] Giraffes were apparently mostly forgotten by the Middle Ages except in legends from Arab travelers.[61] The Medici giraffe was a giraffe presented to Lorenzo de' Medici in 1486. It caused a great stir on its arrival in Florence,[62] being reputedly the first living giraffe to be seen in Italy since the days of Ancient Rome. Another famous giraffe, called Zarafa, was brought from Africa to Paris in the early 19th century and kept in a menagerie for 18 years.

Painting of a giraffe taken from Somalia to China during the Ming Dynasty.[63]

Giraffe is a novel by the author J. M. Ledgard. The work concerns a true incident in which 49 giraffes were slaughtered in the Czech Republic (then Czechoslovakia) in 1975 following the suspected outbreak of disease amongst the group. The novel contains extensive information about the species, including the long history of European fascination with the beast and its captivity in zoos.

Giraffes can be seen in paintings, including the famous painting of a giraffe which was taken from Somalia to China in 1414. The giraffe was placed in a Ming Dynasty zoo.[64] At one point the giraffe was associated with the mythical Qilin, and a derivative of that name (kirin) is still used as the word for giraffe in Japan, Taiwan, and Korea.

Giraffes continue to have a presence in modern popular culture; most notably Toys "R" Us mascot Geoffrey the Giraffe. They also appear as miscellaneous characters in films like The Lion King and Dumbo. They have had more prominent roles with Melman from Madagascar and Longrack from the Transformers universe.

Scientific inspiration

Giraffes have been used as examples for introducing ideas in evolution, especially to illustrate the ideas of Lamarck. Lamarck believed that the giraffe's long neck developed as a result of ancestral giraffe's reaching to browse on the leaves of tall trees.[65] In addition the coat patterns of several subspecies of giraffe have been modelled using reaction-diffusion mechanisms.[66] The giraffe's circulatory system has been studied by NASA which hopes to replicate the the giraffe's ability to keep blood from pooling in its lower body for astronauts returning from space.[67]

Conservation

The last viable population of the West African Giraffe is between Kouré and the Dosso Reserve in Niger.

Overall, the giraffe is regarded as Least Concern from a conservation perspective by the International Union for Conservation of Nature (IUCN), as it still is widespread and occurs in numerous reserves.[2] However, the giraffe has been extirpated from many parts of its former range, including Burkina Faso, Eritrea, Guinea, Malawi, Mauritania and Senegal.[2] It may also have disappeared from Angola, Mali and Nigeria.[2] Two subspecies, the West African Giraffe (G. c. peralta) and the Rothschild Giraffe (G. c. rothschildi), have been classified as endangered[20][68] with wild populations of each of these numbering in the hundreds.[15] Additionally, it has been suggested that the Nubian Giraffe (G. c. camelopardalis) is the most threatened of all giraffes[12] and may number fewer than 250, but little recent information is available and consequently that estimate is labelled with considerable uncertainty.[15]

Giraffes are hunted for their tails, hides and meat.[57] The tails are used as good luck charms, thread and flyswatters.[57] In addition, habitat destruction also hurts the giraffe. In the Sahel trees are cut down for firewood and to make way for livestock. Normally, giraffes are able to cope with livestock since they feed in the trees above their heads. The giraffe is a protected species in most of its range. The total African giraffe population has been estimated to range from 110,000 to 150,000. Kenya (45,000), Tanzania (30,000), and Botswana (12,000), have the largest national populations.[69] More recent estimates suggest fewer than 80,000 remain in total.[15]

References

  1. ^ a b c Wilson, Don E.; Reeder, DeeAnn M., eds (2005). Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 136–138. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14200476. 
  2. ^ a b c d e f Fennessy, J.; Brown, D. (2008). Giraffa camelopardalis. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 13 March 2009.
  3. ^ a b Dagg, A. I. (1971). Mammalian Species 5 (Giraffa camelopardalis ed.). pp. 1–8. 
  4. ^ a b Skinner, J. D. & Smithers, R. H. M. (1990). The mammals of the southern African subregion. Pretoria: University of Pretoria. 
  5. ^ Wood, W. F. & Weldon, P. J. The scent of the reticulated giraffe Giraffa camelopardalis reticulata. Biochemical Systematics and Ecology, 30, 913 - 917, (2002). Abstract
  6. ^ Tobler, I. and Schwierin, B (2006). Behavioural sleep in the giraffe (Giraffa camelopardalis) in a zoological garden. Journal of Sleep Research. pp. 21–32. http://onlinelibrary.wiley.com/doi/10.1046/j.1365-2869.1996.00010.x/abstract. 
  7. ^ Naish, Darren. "Sleep behaviour and sleep postures". science blogs.com. http://scienceblogs.com/tetrapodzoology/2008/09/natural_history_of_sleep.php. Retrieved 3 January 2011. 
  8. ^ David. "Camelopard". Dave's Mythical Creatures and Places. http://www.eaudrey.com/myth/camelopard.htm. Retrieved 2009-03-04. 
  9. ^ Stevens, J. (1993). "Familiar Strangers". International Wildlife 23: 6–10. 
  10. ^ a b Savage, R. J. G.; Long, M. R. (1986). Mammal Evolution: an illustrated guide. New York: Facts on File. pp. 228–229. ISBN 0-8160-1194-X. 
  11. ^ Linnaeus, Carolus (1758) (in Latin). Systema naturae per regna tria naturae :secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis.. 1 (10th ed.). Holmiae (Laurentii Salvii). p. 66. http://www.biodiversitylibrary.org/page/726936#page/79/mode/1up. Retrieved 8 September 2008. 
  12. ^ a b c d e f Kingdon, J. (1997). The Kingdon Field Guide to African Mammals. Academic Press. pp. 339–344. ISBN 0-12-408355-2. 
  13. ^ Brown DM; Brenneman RA; Koepfli K-P; Pollinger JP; Milá B; Georgiadis NJ; Louis Jr. EE; Grether GF; Jacobs DK; Wayne RK (2007). "Extensive population genetic structure in the giraffe". BMC Biology 5: 57. doi:10.1186/1741-7007-5-57. PMC 2254591. PMID 18154651. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2254591. 
  14. ^ a b c d e f g h i j k l m n See "Giraffe and Okapi" entry for The Encyclopedia of Mammals (edited by David MacDonald, Oxford University Press) on pgs. 520–527. ISBN 0871968711
  15. ^ a b c d e f g h i j k l Giraffe Conservation Foundation. Giraffe – The Facts. Accessed 21 December 2010.
  16. ^ UAE Interact. Nubian giraffe born in Al Ain zoo. Accessed 21 December 2010.
  17. ^ a b c d e Rothschild's Giraffe Project. Giraffe subspecies Version 18 December 2010
  18. ^ a b c d e f g ISIS (2010). Giraffa. Version 4 November 2010.
  19. ^ a b c d e Hassanin, A., A. Ropiquet, A. L. Gourmand, B. Chardonnet, J. Rigoulet (2007). Mitochondrial DNA variability in Giraffa camelopardalis: consequences for taxonomy, phylogeography and conservation of giraffes in West and central Africa. Comptes Rendus Biologies 330(3): 265–274.
  20. ^ a b Fennessy, J.; Brown, D. (2008). Giraffa camelopardalis ssp. rothschildi. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 13 March 2009.
  21. ^ a b Brown, David M., et al. (2007). "Extensive Population Genetic Structure in the Giraffe". BMC Biology 5 (57): 57. doi:10.1186/1741-7007-5-57. PMC 2254591. PMID 18154651. http://www.biomedcentral.com/1741-7007/5/57. Retrieved 2009-03-04. 
  22. ^ Brenneman, Rick A.; Louis, Edward E. Jr; Fennessy, Julian (2009). "Genetic structure of two populations of the Namibian giraffe, Giraffa camelopardalis angolensis". African Journal of Ecology 47 (4): 720–728. doi:10.1111/j.1365-2028.2009.01078.x. 
  23. ^ Lever, A. (2007-12-21). "Not one but 'six giraffe species'". BBC News. http://news.bbc.co.uk/1/hi/sci/tech/7156146.stm. Retrieved 2009-03-04. 
  24. ^ Estes, R. (1991). The Behavior Guide to African Mammals. University of California Press. pp. 202–207. ISBN 0-520-08085-8. 
  25. ^ "San Diego Zoo's Animal Bytes: Giraffe". http://www.sandiegozoo.org/animalbytes/t-giraffe.html. Retrieved 2009-03-04. 
  26. ^ Garland, T; Janis CM (1993). "Does metatarsal/femur ratio predict maximal running speed in cursorial mammals?" (pdf). Journal of Zoology 229 (1): 133–151. doi:10.1111/j.1469-7998.1993.tb02626.x. http://www.biology.ucr.edu/people/faculty/Garland/GarlandJanis1993.pdf. 
  27. ^ a b c d e Mammal Anatomy: An Illustrated Guide. Marshall Cavendish Corporation. (2010) pp. 64–81. ISBN 0761478825
  28. ^ a b c Nicole Helget, Giraffes. The Creative Company, (2008) ISBN 1583416544
  29. ^ Pienaar, U de V (1969). "Predator–prey relationships amongst the larger mammals of the Kruger National Park". Koedoe 12: 108–176. 
  30. ^ a b Estes, R. (1991). The Behavior Guide to African Mammals, Including Hoofed Mammals, Carnivores, Primates. Los Angeles: University of California Press. pp. 202–207. ISBN 0520080858. 
  31. ^ a b Henderson DM, Naish D (2010). "Predicting the buoyancy, equilibrium and potential swimming ability of giraffes by computational analysis". J Theor Biol 265 (2): 151–9. doi:10.1016/j.jtbi.2010.04.007. PMID 20385144. 
  32. ^ a b c Naish, Darren (January 2011). "Will it Float?". Scientific American 304 (1): 22. http://www.scientificamerican.com/article.cfm?id=will-it-float. 
  33. ^ a b c Badlangana, Ludo N.; J. W. Adams, and P. R. Manger (2009). "The giraffe (Giraffa camelopardalis) cervical vertebral column: A heuristic example in understanding evolutionary processes?". Zoological Journal of the Linnean Society 155: 736–757. doi:10.1111/j.1096-3642.2008.00458.x. 
  34. ^ a b Van Stittert, S. J.; J. D. Skinner, and G. Mitchell (2010). "From fetus to adult – An allometric analysis of the giraffe vertebral column.". Journal of Experimental Zoology Part B Molecular and Developmental Evolution 314B: 469–479. doi:10.1002/jez.b.21353. 
  35. ^ Solounias, N. (1999) The remarkable anatomy of the giraffe's neck. J. Zool., Lond. 247:257–268 PDF
  36. ^ a b c Simmons, R. E.; R. Altwegg (2010). "Necks-for-sex or competing browsers? A critique of ideas on the evolution of giraffe.". Journal of Zoology 282: 6–12. doi:10.1111/j.1469-7998.2010.00711.x. 
  37. ^ a b du Toit, J. T. (1990). "Feeding-height stratification among african browsing ruminants.". African Journal of Ecology 28: 55–62. doi:10.1111/j.1365-2028.1990.tb01136.x. 
  38. ^ Cameron, E. Z. & du Toit, J. T. (2007). "Winning by a Neck: Tall Giraffes Avoid Competing with Shorter Browsers". American Naturalist 169 (1): 130–135. doi:10.1086/509940. PMID 17206591. 
  39. ^ Woolnough, A. P., and J. T. Du Toit (2001). "Vertical zonation of browse quality in tree canopies exposed to a size-structured guild of African browsing ungulates.". Oecologia (Berlin) 129: 585–590. 
  40. ^ a b c Young, T.P.;Isbell, L.A. (1991). "Sex differences in giraffe feeding ecology: energetic and social constraints". Ethology 87: 79–89. doi:10.1111/j.1439-0310.1991.tb01190.x. 
  41. ^ a b Simmons, R. E. & Scheepers, L. (1996). "Winning by a Neck: Sexual Selection in the Evolution of Giraffe". The American Naturalist 148 (5): 771–786. doi:10.1086/285955. http://bill.srnr.arizona.edu/classes/182/Giraffe/WinningByANeck.pdf. 
  42. ^ Pratt, D. M.; Anderson, V. H. (1985). "Giraffe social behavior.". Journal of Natural History 19: 771–782. doi:10.1080/00222938500770471. 
  43. ^ Mitchell, G., S. J. van Sittert, and J. D. Skinner. (2009). "Sexual selection is not the origin of long necks in giraffes.". Journal of Zoology 278: 281–286. doi:10.1111/j.1469-7998.2009.00573.x. 
  44. ^ Mitchell, Graham; van Sittert, Sybrand J.; Skinner, John D. (2009). (fulltext) "The structure and function of giraffe jugular vein valves". South African Journal of Wildlife Research 39 (2): 175–180. doi:10.3957/056.039.0210. https://repository.up.ac.za/upspace/bitstream/2263/13994/1/Mitchell_Structure(2009).pdf (fulltext). Retrieved 29 December 2010. 
  45. ^ van der Jeugd, H.P. & H.H.T. Prins. (2000). "Movements and group structure of giraffe (Giraffa camelopardalis) in Lake Manyara National Park, Tanzania.". Journal of Zoology 251: 15–21. doi:10.1111/j.1469-7998.2000.tb00588.x. 
  46. ^ a b c d e Leuthold, B.M. (1979). "Social organization and behaviour of giraffe in Tsavo East National Park." African Journal of Ecology 17: 19–34. doi=10.1111/j.1365-2028.1979.tb00453.x
  47. ^ a b c d e f Pratt D.M., Anderson V.H. (1985). "Giraffe social behavior". Journal of Natural History 19: 771–81. doi:10.1080/00222938500770471. http://www.informaworld.com/smpp/content~db=all~content=a770664747~frm=abslink. 
  48. ^ Ciofolo, I., and Y. Le Pendu. (2002). "The feeding behavior of giraffe in Niger." Mammalia 66: 183–94. Preview
  49. ^ a b c d e Dagg, A.I., and J.B. Foster. The giraffe: its biology, behavior, and ecology. New York: Van Nostrand Reinhold, 1976. ISBN 0898742757
  50. ^ "Infrasound From the Giraffe". Animalvoice.com. http://www.animalvoice.com/Giraffe.htm. Retrieved 2009-03-08. 
  51. ^ "Mammal Guide – Giraffe". Animal Planet. http://animal.discovery.com/guides/mammals/habitat/tropgrassland/giraffe.html. Retrieved 2009-03-07. 
  52. ^ a b c d Langman, V.A. (1977). "Cow-calf relationships in giraffe (Giraffe camelopardalis giraffa)" Zeitschrift fur Tierpsychologie 43: 264–86. doi:10.1111/j.1439-0310.1977.tb00074.x
  53. ^ "Woodland Park Zoo euthanizes ailing giraffe". Seattle Times. 2009-11-17. http://seattletimes.nwsource.com/html/localnews/2010287334_webgiraffe17m.html. Retrieved 2009-12-18. 
  54. ^ Simmons Robert E., Scheepers Lue (1996). "Winning by a neck: Sexual selection in the evolution of giraffe" (PDF). The American Naturalist 148: 771–786. doi:10.1086/285955. http://bill.srnr.arizona.edu/classes/182/Giraffe/WinningByANeck.pdf. 
  55. ^ Coe, M.J. (1967). "Necking" behavior in the giraffe." Journal of Zoology, London 151: 313–321. doi:10.1111/j.1469-7998.1967.tb02117.x
  56. ^ Bruce Bagemihl, Biological Exuberance: Animal Homosexuality and Natural Diversity, St. Martin's Press, 1999; pp.391–393. ISBN 0312192398
  57. ^ a b c d e "Giraffe". African Wildlife Foundation. http://www.awf.org/content/wildlife/detail/giraffe. Retrieved 2009-03-07. 
  58. ^ Pérez W, Lima M, Clauss M (2009). "Gross anatomy of the intestine in the giraffe (Giraffa camelopardalis)".". Anat Histol Embryol 38 (6): 432–5. doi:10.1111/j.1439-0264.2009.00965.x. PMID 19681830. 
  59. ^ Jentz D.C., Gull A.B. (1978). "Towards a definition of abnormal activity: stereotypic behaviours in captive primates". Mamm. Ecol. 12: 145–154. 
  60. ^ Harrison J.C, George Q.F., Cronk C.C. (2001). "Stereotypic behaviour in zoo animals". J. Zoo Sc. 23: 71–86. 
  61. ^ a b c d e Prothero D.R, Schoch R. M, 2003, Horns, Tusks, and Flippers: The Evolution of Hoofed Mammals, The Johns Hopkins University Press. pgs 67–68. ISBN 0801871352
  62. ^ Erik Ringmar. "Audience for a Giraffe: European Expansionism and the Quest for the Exotic". Journal of World History, 17:4, December, 2006. pp. 353–97. http://www.archive.org/download/ErikRingmaraudienceForAGiraffeEuropeanExceptionalismAndTheQuest_744/ErikRingmarAudienceForAGiraffe.pdf. 
  63. ^ "Zheng He (Cheng Ho)". Hyperhistory.net. http://www.hyperhistory.net/apwh/bios/b3zhenghe.htm. Retrieved 2008-09-01. 
  64. ^ Laufer, Berthold (1928). The Giraffe in History and Art. Field Museum of Natural History, Chicago. http://www.archive.org/details/giraffeinhistory27lauf. 
  65. ^ Holdrege, C. (2003). "The Giraffe's Short Neck". In Context (The Nature Institute) (10): 14–19. http://www.natureinstitute.org/pub/ic/ic10/giraffe.htm. Retrieved 2009-04-06. 
  66. ^ Walter, Marcelo; Fournier,, Alain and Menevaux, Daniel (2001) Integrating shape and pattern in mammalian models in SIGGRAPH '01: Proceedings of the 28th annual conference on Computer graphics and interactive techniques. pp. 317–326 doi:http://doi.acm.org/10.1145/383259.383294
  67. ^ NASA Quest - Why Giraffes Don't Faint Lisa Marie Gonzales
  68. ^ Fennessy, J. & Brown, D. (2008). Giraffa camelopardalis ssp. peralta. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 13 March 2009.
  69. ^ East, R. 1998, in: African Antelope Database 1998. IUCN/SSC Antelope Specialist Group Report.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!