Overview

Brief Summary

Description

Spectacularly tall, the giraffe has a very long neck with a short, upstanding mane, and high shoulders that slope steeply to the hindquarters. The legs are also long. The giraffe's neck is made up of the same number of neck bones (vertebrae) as most mammals, including humans, but they are much larger and linked by ball and socket joints for improved flexibility (4). The specific name of the giraffe comes from the Latin 'camelopardalis', meaning 'camel marked like a leopard', owing to their buff background with brown blotches, which helps to camouflage them in the dappled light and shade patterns created by the trees they feed on (5). The various subspecies of giraffe differ slightly in colouration and patterning. The reticulated giraffe of northeastern Kenya (Giraffa camelopardalis reticulata) has large, chestnut-coloured patches outlined by thin white lines. Rothschild's giraffe of western Kenya and eastern Uganda (Giraffa camelopardalis rothschildi) has broader dividing white lines than the reticulated giraffe, and no spotting beneath the knees. The Masai giraffe of Tanzania and southern Kenya (Giraffa camelopardalis tippelskirchi) has irregular star-shaped light to dark brown spots. Giraffes have two horn-like structures about 13 cm long made of skin-covered bone; they are thin and tufted in females and thick and bald on top in males, as a result of wearing during fights with other males (3). Males can develop calcium depositions on their heads in addition to their horns as they age. These help to deliver heavier blows during fights with other males (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

The giraffe is non-territorial and sociable, forming loose herds with no permanent members in very variable home ranges of between 5 and 650 km² (3). Females tend to associate most with one another when they have young, as the calves tend to play together in crèches (3). Males leave their mothers at around three years, and sometimes form roaming bachelor herds that look for females (cows) in heat (3). Males spar with each other at all ages, standing side by side and swinging their necks to thump their head into the other male's body. These fights can be quite gentle, or quite fierce, sometimes resulting in knocked-out giraffes (2). Mating occurs year-round, peaking in the rainy season, and results in pregnancies lasting 15 months. Females will usually become pregnant for the first time in their fourth year (3). The single calf begins life with a two metre drop, as females give birth standing up (7). The newborn calf is able to stand within 20 minutes and will grow about 2.1 m in its first year. At a year old, young giraffes have been weaned but remain close to them until at least 22 months old, often remaining nearby for life (3). Despite the females' attempts to stand over their calves during attacks by lions, spotted hyenas, leopards and African wild dogs (6), many calves are killed in their first few months (3). Sexual maturity occurs at three to four years in both males and females, but males rarely have the opportunity to mate before seven years old (3). Life expectancy in the wild is 20 years (6). Using its 45 cm prehensile, black tongue, the giraffe rips the thorny leaves from Acacia and Combretum trees and may eat as many as 100 other plant species (3). Reaching higher than any other mammal, the giraffe can eat up to 134 kg of leaves a day, and can ruminate whilst walking (3). These enormous animals do not migrate as they can obtain most of the moisture they need from their diet, but they will drink every two to three days when water is available. It is possible to distinguish the sexes from a distance as males more often extend their heads in line with their necks to reach branches higher than those the females are feeding from, with bent necks (4). With strong eyesight from an elevated position and a good sense of smell, giraffes are often accompanied by zebra and wildebeest which may benefit from the giraffe as an 'early warning system' (8). Whilst it was thought that giraffes did not make any sounds, this is now known to be untrue, as giraffes bellow, snort, hiss and make flute-like sounds, as well as low pitch noises beyond the range of human hearing (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Giraffe formerly occurred in arid and dry-savanna zones of sub-Saharan Africa, wherever trees occur. Today, its range has contracted markedly with the expansion of human populations, especially in West Africa.

In West Africa, Giraffe formerly ranged from Senegal to Lake Chad, but the only viable surviving population within this entire area is a small population in south-western Niger with a range of about 15,000 km² (Boulet et al. 2004). This represents the only surviving wild population of G. c. peralta; a small population observed in the Ansongo-Menaka Partial Faunal Reserve in Mali, on the border of Niger, is presumed to be extinct.

Giraffe are still present in northern Cameroon, southern Chad, Central African Republic and in Garamba National Park in north-eastern Democratic Republic of Congo (East 1999); there is limited information on their occurrence in Sudan, west of the Nile (where they were not recorded at all during the course of recent surveys), but they do still occur in the south-east (in Boma National Park) (Fay et al. 2007). In East and north-east Africa, Giraffe still occur in relatively large numbers in northern Kenya, mainly outside protected areas, in south-western and southern Ethiopia, Somalia, and in small numbers in a few protected areas in Uganda; they are now extinct in Eritrea. Giraffe remain relatively widely distributed through southern Kenya and Tanzania. Of some concern is the status of Rothschild’s Giraffe, for which the only remaining naturally occurring population occurs in Murchison Falls National Park, Uganda. Rothschild's Giraffes have been re-introduced to six sites in Kenya (Ruma National Park; Mt Elgon National Park; Murgor Farm, Iten; Sergoit-Kruger Farm, Iten; Kitale Area Farm; Nasalot Reserve) and one site in Uganda (Kidepo Valley National Park) within the native range. Six extralimital introductions have also taken place in Kenya.

There is an isolated population of Giraffe (Thornicroft’s Giraffe G. c. thornicrofti) in the Luangwa Valley (Zambia).

In southern Africa, having been reintroduced to many parts of the range from which they were eliminated, Giraffes are currently common both inside and outside a number of protected areas in Namibia, Botswana, Zimbabwe and South Africa. In Angola, the Giraffe is now assumed to be extinct. A few animals are reported to still survive in Sioma Ngwezi National Park in south-western Zambia, while in Mozambique, a few individuals still occur in the area adjacent to Kruger National Park. Giraffe have been introduced to Swaziland (Giraffe Conservation foundation pers. obs., J. Fennessy pers. obs., Ciofolo and Pendu in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Giraffa camelopardalis is native to Africa, mainly found south of the Sahara to eastern Transvaal, Natal, and northern Botswana. Giraffes have disappeared from most of western Africa, except a residual population in Niger. They have been reintroduced in South Africa to game reserves.

Biogeographic Regions: ethiopian (Native )

  • 2003. Grzimek's Animal Life Encyclopedia. Pp. 399-408 in M Hutchins, D Kleiman, V Geist, M McDade, eds. Okapis and giraffes, Vol. 15: IV, 2 Edition. Farmington Hills, MI: Gale Group.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The giraffe is found south of the Sahara in Africa (4), but has been eliminated from most of western Africa and the southern Kalahari (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Giraffa camelopardalis is the world’s tallest mammal. Male giraffes (bulls) stand a total of 5.7 m from the ground to their horns: 3.3 m at the shoulders with a long neck of 2.4 m. Female giraffes (cows) are 0.7 to 1 m shorter than bulls. Bulls weigh up to 1,930 kg, while cows can weigh up to 1,180 kg. At birth, giraffe calves are 2 m tall from the ground to the shoulders. Newborn giraffes weigh 50 to 55 kg.

Both male and female giraffes have a spotted coat. The pattern of the coat varies and is an aide for camouflage with the different habitats. The nine giraffe subspecies have various skin patterns. The patches on a giraffe coat can be small, medium, or large in size. Giraffe coats are sharp-edged or fuzzy-edged; small, medium, or large; or yellow to black in color. The skin pattern for an individual giraffe is constant throughout the giraffe’s life. With the changing of season and health, the coat color may be altered.

Giraffa camelopardalis have long, sturdy legs, with their front legs longer than their back legs. Giraffe necks contain 7 elongated vertebrae. Giraffes have a steeply sloping back from the shoulders to the rump. Their tails are thin and long, measuring about 76 to 101 cm in length. A black tuft at the end of the tail whisks away flies and other flying insects. Giraffe horns, called ossicones, are bone protuberances covered with skin and fur. Female giraffe horns are thin and tufted; male giraffe horns are thick but the hair is smoothed by sparring. A medium-sized horn is common in both male and females; while males can grow a second pair behind the first pair of horns. The eyes are very large and their 45 cm long black tongue grasps prickly food from the very tops of trees.

Range mass: 1180 to 1930 kg.

Range length: 4.7 to 5.7 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

  • Burnie, D., D. Wilson. 2001. Smithsonian Institution Animal: The Definitive Visual Guide to the World's Wildlife. New York: DK Publishing, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Typically associated with Acacia, Commiphora and Combretum savannas, but they also occur marginally in miombo Brachystegia woodland and in Isoberlina woodland, in Cameroon (Ciofolo and Pendu in press). Giraffes are selective browsers, with Acacia species forming the bulk of their diet throughout the range, but also species of the genera Balanites, Commiphora, Detarium, Boscia, Combretum, Ziziphus and Grewia (Ciofolo and Pendu in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Giraffes inhabits arid, dry land. They seek out areas enriched with Acacia growth. Giraffes are found in savannas, grasslands, or open woodlands. Because they only occasionally drink, giraffes can be found away from a water source. Male giraffes can venture into denser wooded areas in search of more foliage.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; scrub forest

  • 1999. Walker's Mammals of the World. Pp. 1084-1089 in R Nowak, ed. Okapi and Giraffe, Vol. 2, 6 Edition. Baltimore, Maryland: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits savanna, scrub, open acacia woodlands and subtropical and tropical grasslands with trees and bushes (1) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Giraffes feed on leaves, flowers, seed pods, and fruits. In areas where the savanna floor is salty or full of minerals, they eat soil as well. Giraffes are ruminants and have a four-chambered stomach. Chewing cud while traveling helps to maximize their feeding opportunities.

Giraffa camelopardalis have long tongues, narrow muzzles, and flexible upper lips to help obtain leaves from the tall trees they use for browsing. Giraffes use many tree species for browse, including: Acacia senegal, Mimosa pudica, Combretum micranthum, and Prunus armeniaca. Their main food is the leaves from Acacia trees. Giraffes browse by taking the branches in their mouths and pulling away the head to tear away the leaves. Acacia trees have thorns but giraffe molars crush the thorns. Up to 66 kg of food for one day can be consumed by an adult, male giraffe. However, in poor-quality areas, a giraffe can survive on 7 kg of food per day.

Male giraffes typically feed with their head and neck completely outstretched to the shoots. Their fodder is from the underside of the high canopy. Female giraffes feed at body and knee height, feeding from the crown of lower trees or shrubs. Female giraffes are more selective when feeding. They choose foliage with highest nutritional value.

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; fruit; flowers

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Giraffes are host to troublesome ticks. Oxpecker birds (Buphagus africanus) rests on the backs and necks of giraffes, removing the ticks from the giraffe skin. There is a mutually beneficial relationship between giraffes and oxpecker birds.

Mutualist Species:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Lions (Panthera leo) are the main predators of giraffes; while leopards (Panthera pardus) and (hyenas Hyaena hyaena) have also been known to prey on giraffes. Adult giraffes are well able to defend themselves. They remain vigilant and are capable of running quickly and delivering deadly blows with their front hooves. Crocodiles may also prey on giraffes when they come to waterholes to drink. Most predators of giraffes target young, sick, or elderly giraffes. The blotchy color of giraffe skin also helps to camouflage them while foraging in scrub forests.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Video of male Giraffes fighting with their necks can be viewed at ARKive.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Giraffa camelopardalis are rarely heard and are usually considered silent mammals. Giraffes communicate with one another by infrasonic sound. They do, at times, vocalize to one another by grunts or whistle-like cries. Some other communication sounds for giraffes are moaning, snoring, hissing, and flutelike sounds. When alarmed, a giraffe grunts or snorts to warn neighboring giraffes of the danger. Mother giraffes can whistle to their young calves. Also, cows search for their lost young by making bellowing calls. The calves return their mother’s calls by bleating or mewing. While courting an estrous cow, male giraffes may cough raucously.

Giraffe vision relies mainly on their height. Their height allows giraffes a continual visual contact while at great distances from their herd. The acute eyesight of giraffes can spot predators at a distance so they can prepare to defend themselves by kicking. Individuals within a herd may scatter widely across the grassland in search of good food or drink, and only cluster together at good food trees or if threatened.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: duets

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Giraffa camelopardalis have a life expectancy between 20 to 27 years in zoos. Giraffes live for 10 to 15 years in the wild.

Range lifespan

Status: wild:
25 (high) years.

Range lifespan

Status: captivity:
27 (high) years.

Typical lifespan

Status: wild:
10 to 15 years.

Typical lifespan

Status: captivity:
20 to 25 years.

Average lifespan

Status: captivity:
25 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 39.5 years (captivity) Observations: There are anecdotal reports of giraffes living over 40 years. One wild born specimen was about 39.5 years when it died in captivity (Richard Weigl 2005). Tooth wear has been suggested to have a significant deleterious impact in captivity (Clauss et al. 2007).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Giraffes are polgynous. Bulls carefully guard an estrous female from other male giraffes. Courtship starts when a bull approaches a cow to perform a urine test, smelling the urine with a pronounced lip curl, a behavior referred to as flehmen. The bull will then proceed to rub his head near the rump of the female and rest it on her back. Male giraffes lick the tail of the female and lift his foreleg. If receptive, the female giraffe will circle the male, hold her tail out, and take on a mating position, after which copulation occurs.

Mating System: polygynous

For Giraffa camelopardalis, conception occurs in the rainy season, with birth occurring in the dry months. Most giraffe births take place from May to August. Female giraffes breed every 20 to 30 months. The gestation period is about 457 days. Mother giraffes give birth standing up or walking. The giraffe calf drops 2 m to the ground. Most often a single calf is born; twins are uncommon but do occur. Newborn calves get to their feet and begin suckling fifteen minutes after birth. The weaning period for female calves is 12 to 16 months; the weaning period for males is 12 to 14 months. The independence period varies between bulls and cows. Cows tend to stay within the herd. However, bulls tend to become solitary until they find or obtain their own herd and become the dominant male. Female giraffes reach sexual maturity at 3 to 4 years of age but do not breed for at least another year. At age 4 to 5 years, male giraffe become sexually mature; however, it is not until seven years of age when they start to breed.

Breeding interval: Giraffes can give birth every 20 to 30 months

Breeding season: Breeding occurs between May and August.

Range number of offspring: 1 (low) .

Range gestation period: 400 to 468 days.

Average gestation period: 457 days.

Range weaning age: 12 to 16 months.

Average weaning age: 12 months.

Range time to independence: 1 to 3 years.

Range age at sexual or reproductive maturity (female): 3 to 4 years.

Range age at sexual or reproductive maturity (male): 4 to 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 58500 g.

Average number of offspring: 1.

A giraffe calf hides throughout much of the day and night of its first week, remaining on the ground. Mother giraffes stay nearby, within 25 m, guarding their young and feeding. At night females return to their young to nurse them.

After three to four weeks, mother giraffes steer their young calves into crèche groups. The crèche group allows mother giraffes to wander further away from the young calf to feed or drink. The mother giraffes take turns watching over all the youngsters in the crèche group. Now the mother giraffe can drift as far as 200 m from her calf. Mothers still return before nightfall to suckle and protect their calf.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • 1997. Encyclopedia of Mammals. Pp. 809-833 in A Brown, et. al., eds. Browsing Giants, Vol. 6. Tarrytown, New York: Marshall Cavendish Corp..
  • 2003. Grzimek's Animal Life Encyclopedia. Pp. 399-408 in M Hutchins, D Kleiman, V Geist, M McDade, eds. Okapis and giraffes, Vol. 15: IV, 2 Edition. Farmington Hills, MI: Gale Group.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Tongue protected from thorns: giraffe
 

The tongues and mouths of giraffes and other ungulates are protected when eating thorny plants because they are leathery.

     
  "Yet giraffe and camels and goats have developed tongues that are so long, mobile and dexterous that they can select and grasp any particular shoot that they want, and the linings to their mouths seem to be so leathery that they can close around the thorns without damage of any kind." (Attenborough 1995:61)
  Learn more about this functional adaptation.
  • Attenborough, D. 1995. The Private Life of Plants: A Natural History of Plant Behavior. London: BBC Books. 320 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Pressure assists blood circulation: giraffe
 

Tight skin of giraffe legs assists blood circulation by creating extravascular pressure.

     
  "Its [giraffe's] heart is two-and-a-half times as big as zoologists would expect for an animal of its size. And the skin around its legs is unusually tight. Pedley [Tim Pedley of the University of Cambridge] says that high blood pressure would encourage blood to pool in a giraffe's legs. The tight skin acts like a support stocking, forcing blood back up into the body." (Thomas 1997:24)
  Learn more about this functional adaptation.
  • Thomas, Jim. 1997. A heart for heights. New Scientist. (2100): 24.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Secretions repel insects, bacteria: giraffe
 

The skin and hair of giraffes may repel ticks, mosquitoes and bacteria via secreted chemical compounds, particularly indole, skatole, and p-cresol.

     
  "…two alkaloids, indole and 3-methylindole (skatole), are primarily responsible for the scent of the giraffe…Indole occurs naturally in the floral scent of jasmine, orange blossom and other flowers (Poucher, 1974). Indole and 3-methylindole have an intense faecal odour at high concentrations that becomes pleasant in very dilute solutions — both are used in perfumery (Poucher, 1974)…Many of these compounds may function as antimicrobial agents…The growth of two ubiquitous species of skin bacteria is inhibited by some of the giraffe-derived compounds…Another possible function of these compounds may be to repel ectoparasitic arthropods. Both indole and skatole were judged by Rudolfs (1922, 1930) to repel wildcaught mosquitoes (Aedes spp.) from the US, but quantitative results are needed to affirm this. A tick found in areas inhabited by giraffes, Rhipicephalus appendiculatus, is repelled by p-cresol, one of the giraffe skin compounds…" (Wood and Weldon 2003:915-916)
  Learn more about this functional adaptation.
  • Wood, W. F.; Weldon, P. J. 2002. The scent of the reticulated giraffe (Giraffa camelopardalis reticulata). Biochemical Systematics and Ecology. 30(10): 913-917.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Giraffa camelopardalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAACCGCTGATTATTTTCAACCAACCACAAAGACATTGGCACCTTATACTTACTATTTGGCGCTTGAGCCGGTATAGTAGGAACAGCCCTAAGCTTACTGATTCGTGCTGAACTGGGCCAACCTGGGACTCTGCTCGGAGACGATCAGATTTATAATGTAGTCGTAACTGCCCATGCATTTGTAATAATTTTCTTCATAGTGATACCAATTATGATTGGGGGATTTGGTAACTGACTCGTCCCCCTGATAATTGGTGCTCCCGACATAGCTTTTCCCCGAATAAATAACATAAGCTTCTGACTTCTCCCCCCTTCATTCCTATTACTCCTGGCATCATCTATAGTGGAGGCCGGGGCAGGAACAGGCTGAACTGTATATCCCCCACTAGCCGGCAACCTAGCCCATGCAGGAGCCTCAGTAGACCTAACTATCTTTTCTCTACATTTAGCAGGTGTCTCCTCAATTCTAGGGGCCATTAATTTTATTACAACAATCATCAATATGAAACCTCCCGCAGTATCACAATACCAAACACCTCTGTTCGTATGATCCGTACTAGTTACTGCTGTACTACTTCTTCTCTCACTCCCTGTACTGGCAGCTGGAATTACTATACTACTGACAGACCGAAATCTAAACACAACATTTTTCGACCCTGCAGGAGGGGGGGATCCAGTCCTATACCAACATCTATTCTGATTTTTTGGGCACCCAGAAGTGTATATTCTTATTCTACCTGGATTTGGAATAATCTCACACATTGTAACCTATTATTCAGGAAAGAAAGAACCGTTCGGATACATGGGAATAGTCTGAGCCATGATATCAATTGGATTTTTGGGCTTCATTGTATGAGCTCACCATATGTTCACAGTTGGAATAGATGTTGACACACGAGCTTACTTCACATCGGCTACCATAATTATTGCCATCCCTACCGGAGTAAAAGTTTTTAGCTGATTAGCAACACTCCACGGAGGCAATATTAAATGATCTCCTGCCTTAATATGAGCTTTAGGCTTCATCTTCCTCTTTACAGTAGGAGGCCTAACTGGAATTGTCTTAGCCAACTCTTCTCTTGATATTGTTCTCCATGATACATATTATGTAGTTGCACACTTCCACTACGTATTGTCAATAGGAGCTGTATTTGCCATCATGGGAGGATTCGTGCACTGATTCCCACTATTCTCAGGTTATACTCTTAACACCACATGAGCTAAAATTCACTTTGTGATCATATTTGTGGGCGTAAATATGACCTTCTTCCCACAACACTTCCTGGGACTATCCGGCATACCACGACGATATTCTGACTACCCAGATGCATACACATTGTGAAATACTATCTCATCTATAGGCTCATTCATCTCTCTAACAGCAGTCGTACTAATAATTTTTATTATCTGAGAGGCATTTGCATCTAAACGGGAAGTCCTAGCCGTAGATCTAACTACAACAAACCTAGAGTGATTGAATGGGTGTCCTCCGCCATATCATACATTTGAAGAGCCTACATACGTCAACTTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Giraffa camelopardalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Fennessy, J. & Brown, D.

Reviewer/s
Hoffmann, M. & Mallon, D.

Contributor/s

Justification
Provisionally listed as Least Concern as the species remains widespread, with a total population numbering more than 100,000 individuals. However, a recent preliminary population estimate suggests a decline in the total population has taken place which, if substantiated, could mean that the species will warrant listing in a higher category of threat. Some populations remain stable or are even increasing, but others are clearly in a more precarious position (and may well be threatened). Ongoing efforts to census the continent's giraffe populations will allow more accurate assessment of the species' overall conservation status, as well as described subspecies in future.

History
  • 1996
    Lower Risk/conservation dependent
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Giraffa camelopardalis populations seem to be stable throughout parts of their range and are threatened in other areas. Giraffes are hunted and poached for their skin, meat, and tail. Habitat destruction also impacts giraffe populations. Giraffe populations remain common in east and southern Africa but have drastically fallen in west Africa. In Niger, conservation of giraffes has been made a priority. In other places where large mammals have disappeared, giraffes have survived. Their survival could be because their height diminishes competition with domestic mammals.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The giraffe is classified as Least Concern (LC) on the IUCN Red List (1). Subspecies: Niger giraffe Giraffa camelopardalis peralta is classified as Endangered on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
East (1999) estimated the total population at about 140,000 animals, predominantly in areas dominated by Acacia woodlands and shrublands. More recent preliminary estimates put the total population at less than 80,000 animals ( International Giraffe Working Group and Giraffe Conservation Foundation pers. comm.); efforts are currently under way to census the continent’s populations more accurately (Fennessy 2007) which will enable a more thorough determination of the conservation status of the species and subspecies.

The population in Niger estimated to number 79 animals in 1999 (Ciofolo et al. 2000), has since increased to more than 200 animals in 2007 ( J Suraud pers. obs.).

In 1998 there was an estimated population of more than 500 Rothschild’s (and Nubian) giraffe, with the populations from Sudan unknown (East 1999). There were an estimated 2,500 individuals in Murchison Falls National Park in the 1960s, declining sharply to 350 in 1982–1983 and 250 in 1995–1996. The current population in Murchison Falls National Park is estimated to be of 240 individuals and stable. The reintroduced population in Ruma National Park, Kenya, is estimated to be of 130 individuals and is declining due to poaching. Numbers at each of the other five reintroduction sites are of 10-20 individuals and some of these are unlikely to be viable. In sum, Rothschild’s Giraffe is estimated to number less than 470 individuals in Uganda and Kenya, with an unknown (but likely small) number in southern Sudan.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
While southern populations are increasing in abundance, northern populations have been decreasing due to habitat degradation and poaching. For example, poaching and armed conflict across the range of the Reticulated Giraffe in Somalia, Ethiopia and Kenya has reduced numbers to perhaps fewer than 5,000 individuals ( Giraffe Conservation Foundation pers. obs., Fennessy 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Giraffes were previously killed for their tails alone, which were used as fly swats, good luck charms and thread for sewing (9). Now, the main threats to the giraffe are habitat loss and poaching for meat and hides (4) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
East (1999) estimated that around 40% of the total population survived in and around protected areas, with the main strongholds including: Waza National Park and the hunting zones of North Province (Cameroon); Zakouma National Park (Chad); Murchison Falls National Park (Uganda); Boma National Park (Sudan); South Luangwa National Park (Zambia); and, in southern Africa, Etosha National Park (Namibia), Hwange National Park (Zimbabwe) and Kruger National Park (South Africa) (East 1999; Ciofolo and Pendu in press). Some of the major protected populations have decreased during the 1990s in national parks such as Serengeti (Tanzania) and Tsavo (Kenya).

In Niger, conservation projects have facilitated the Niger Giraffe’s population recovery in an area outside any formal protected park or reserve. However, poaching and habitat loss and degradation as a result of increased aridity, and expansion of human activities remain threats (Ciofolo and Pendu in press). This small population survives only in the wild, since the Giraffes held in captivity in the Vincennes Zoo, France, which were long considered to represent peralta, in fact belong to the subspecies antiquorum (Hassanin et al. 2007).

Rothschild's Giraffe is one of the most imperilled Giraffe subspecies remaining. Exact numbers of giraffes in MurchisonFallsNational Park are approximate due to lack of surveys but are most recently estimated at approximately 240 individuals. Determining exact population numbers and conservation status of the Murchison Falls National Park Rothschild's Giraffe population is a priority for long-term conservation of this subspecies. Wildlife Conservation Society are planning a survey in 2010.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Giraffes are protected where they occur in National Parks and private game parks, and whilst they are also protected by hunting laws, poaching still occurs (4). The giraffe is involved in a Species Survival Program for captive individuals in American zoos, which includes the education of the public in conservation matters as well as cooperation with other conservation agencies (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of giraffes on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In many zoos and wildlife parks, giraffes serve as an attraction. Giraffes have been killed for their meat and hide. The thick skin has been made into buckets, reins, whips, straps for harnesses, and sometime for musical instruments.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Giraffe

The giraffe (Giraffa camelopardalis) is an African even-toed ungulate mammal, the tallest living terrestrial animal and the largest ruminant. Its species name refers to its camel-like appearance and the patches of color on its fur. Its chief distinguishing characteristics are its extremely long neck and legs, its horn-like ossicones and its distinctive coat patterns. It stands 5–6 m (16–20 ft) tall and has an average weight of 1,600 kg (3,500 lb) for males and 830 kg (1,800 lb) for females. It is classified under the family Giraffidae, along with its closest extant relative, the okapi. The nine subspecies are distinguished by their coat patterns.

The giraffe's scattered range extends from Chad in the north to South Africa in the south, and from Niger in the west to Somalia in the east. Giraffes usually inhabit savannas, grasslands, and open woodlands. Their primary food source is acacia leaves, which they browse at heights most other herbivores cannot reach. Giraffes are preyed on by lions, and calves are also targeted by leopards, spotted hyenas and wild dogs. Adult giraffes do not have strong social bonds, though they do gather in loose aggregations if they happen to be moving in the same general direction. Males establish social hierarchies through "necking", which are combat bouts where the neck is used as a weapon. Dominant males gain mating access to females, which bear the sole responsibility for raising the young.

The giraffe has intrigued various cultures, both ancient and modern, for its peculiar appearance, and has often been featured in paintings, books and cartoons. It is classified by the International Union for Conservation of Nature as Least Concern, but has been extirpated from many parts of its former range, and some subspecies are classified as Endangered. Nevertheless, giraffes are still found in numerous national parks and game reserves.

Contents

Etymology [edit]

The name "giraffe" has its earliest known origins in the Arabic word zarafa (زرافة), perhaps from some African language.[3] The name is translated as "fast-walker".[4] There were several Middle English spellings such as jarraf, ziraph, and gerfauntz.[3] The word possibly was derived from the animal's Somali name geri.[5] The Italian form giraffa arose in the 1590s.[3] The modern English form developed around 1600 from the French girafe.[3] The species name camelopardalis is from Latin.[6]

Kameelperd is also the name for the species in Afrikaans.[7] Other African names for the giraffe include ekorii (Ateso), kanyiet (Elgon), nduida (Gikuyu), tiga (Kalenjin and Luo), ndwiya (Kamba), nudululu (Kihehe), ntegha (Kinyaturu), ondere (Lugbara), etiika (Luhya), kuri (Ma'di), oloodo-kirragata or olchangito-oodo (Maasai), lenywa (Meru), hori (Pare), lment (Samburu) and twiga (Swahili and others) in the east;[8]:313 and tutwa (Lozi), nthutlwa (Shangaan), indlulamitsi (Siswati), thutlwa (Sotho), thuda (Venda) and ndlulamithi (Zulu) in the south.[7]

Taxonomy and evolution [edit]

The giraffe is one of only two living species of the family Giraffidae, the other being the okapi. The family was once much more extensive, with over 10 fossil genera described. Their closest known relatives are the extinct climacocerids. They, together with the family Antilocapridae (whose only extant species is the pronghorn) belong to the superfamily Giraffoidea. These animals evolved from the extinct family Palaeomerycidae 8 million years ago (mya) in south-central Europe during the Miocene epoch.[9]

While some ancient giraffids like Sivatherium had massive bodies, others like Giraffokeryx, Palaeotragus (possible ancestor of the okapi), Samotherium, and Bohlinia were more elongated.[9] Bohlinia entered China and northern India in response to climate change. From here, the genus Giraffa evolved and, around 7 mya, entered Africa. Further climate changes caused the extinction of the Asian giraffes, while the African ones survived and radiated into several new species. G. camelopardalis arose around 1 mya in eastern Africa during the Pleistocene.[9] Some biologists suggest that the modern giraffe descended from G. jumae;[10] others find G. gracilis a more likely candidate.[9] The main driver for the evolution of the giraffes is believed to have been the change from extensive forests to more open habitats, which began 8 mya.[9] Some researchers have hypothesized this new habitat with a different diet, including Acacia, may have exposed giraffe ancestors to toxins that caused higher mutation rates and a higher rate of evolution.[11]

The giraffe was one of the many species first described by Carl Linnaeus in 1758. He gave it the binomial name Cervus camelopardalis. Morten Thrane Brünnich classified the genus Giraffa in 1772.[12] In the early 19th century, Jean-Baptiste Lamarck believed the giraffe's long neck was an "acquired characteristic", developed as generations of ancestral giraffes strived to reach the leaves of tall trees.[13] This theory was eventually rejected, and scientists now believe the giraffe's neck arose through Darwinian natural selection—that ancestral giraffes with long necks thereby had a competitive advantage that better enabled them to reproduce and pass on their genes.[13]

Subspecies [edit]

"Approximate geographic ranges, fur patterns and phylogenetic relationships between some giraffe subspecies based on mitochondrial DNA sequences. Colored dots on the map represent sampling localities. The phylogenetic tree is a maximum-likelihood phylogram based on samples from 266 giraffes. Asterisks along branches correspond to node values of more than 90% bootstrap support. Stars at branch tips identify paraphyletic haplotypes found in Maasai and Reticulated giraffes".[14]

Up to nine subspecies of giraffe are recognized (with population estimates as of 2010):

The endangered West African giraffe

Giraffe subspecies are distinguished by their coat patterns. The reticulated and Masai giraffes represent two extremes of giraffe patch shapes. The former has neatly shaped patches, while the latter has jagged ones.[24] The width of the lines separating the patches also differ. The West African giraffe has thick lines, while the Nubian and reticulated giraffes have thin ones.[8]:321–22 The former also has a lighter pelage than other subspecies.[8]:322

A 2007 study on the genetics of six subspecies—the West African, Rothschild, reticulated, Masai, Angolan, and South African giraffe—suggests they may, in fact, be separate species. The study deduced from genetic drift in nuclear and mitochondrial DNA (mtDNA) that giraffes from these populations are reproductively isolated and rarely interbreed, though no natural obstacles block their mutual access.[14] This includes adjacent populations of Rothschild, reticulated, and Masai giraffes. The Masai giraffe may also consist of a few species separated by the Rift Valley. Reticulated and Masai giraffes have the highest mtDNA diversity, which is consistent with the fact that giraffes originated in eastern Africa. Populations further north evolved from the former, while those to the south evolved from the latter. Giraffes appear to select mates of the same coat type, which are imprinted on them as calves.[14] The implications of these findings for the conservation of giraffes were summarised by David Brown, lead author of the study, who told BBC News: "Lumping all giraffes into one species obscures the reality that some kinds of giraffe are on the brink. Some of these populations number only a few hundred individuals and need immediate protection."[25]

The West African giraffe is more closely related to the Rothchild and reticulated giraffes than to the Kordofan giraffe. Its ancestor may have migrated from eastern to northern Africa and then to its current range with the development of the Sahara desert. At its largest, Lake Chad may have acted as a barrier between West African and Kordofan giraffes during the Holocene.[21]

Appearance and anatomy [edit]

Closeup of the head of a giraffe at the Melbourne Zoo
Giraffe skeleton on display at the Museum of Osteology, Oklahoma City, Oklahoma

Fully grown giraffes stand 5–6 m (16–20 ft) tall, with males taller than females.[12] The average weight is 1,192 kg (2,630 lb) for an adult male and 828 kg (1,830 lb) for an adult female.[26] Despite its long neck and legs, the giraffe's body is relatively short.[27]:66 Located at both sides of the head, the giraffe's large, bulging eyes give it good all-round vision from its great height.[28]:25 Giraffes see in color[28]:26 and their senses of hearing and smell are also sharp.[13] The animal can close its muscular nostrils to protect against sandstorms and ants.[28]:27 The giraffe's prehensile tongue is about 50 cm (20 in) long. It is purplish-black in color, perhaps to protect against sunburn, and is useful for grasping foliage, as well as for grooming and cleaning the animal's nose.[28]:27 The upper lip of the giraffe is also prehensile and useful when foraging. The lips, tongue and inside of the mouth are covered in papillae to protect against thorns.[12]

(video) A pair of giraffes at Tobu Zoo, in Saitama, Japan

The coat has dark blotches or patches (which can be orange, chestnut, brown or nearly black in color[13]) separated by light hair (usually white or cream in color[13]). Male giraffes become darker as they age.[24] The coat pattern serves as camouflage, allowing it to blend in the light and shade patterns of savanna woodlands.[9][15] The skin underneath the dark areas may serve as windows for thermoregulation, being sites for complex blood vessel systems and large sweat glands.[29] Each individual giraffe has a unique coat pattern.[24] The skin of a giraffe is mostly gray.[26] It is also thick and allows it to run through thorn bush without being punctured.[28]:34 The fur may serve as a chemical defence, as its parasite repellents give the animal a characteristic scent. At least 11 main aromatic chemicals are in the fur, although indole and 3-methylindole are responsible for most of the smell. Because the males have a stronger odor than the females, the odor may also have sexual function.[30] Along the animal's neck is a mane made of short, erect hairs.[12] The one-meter (3.3-ft) tail ends in a long, dark tuft of hair and is used as a defense against insects.[28]:36

Skull and ossicones [edit]

Both sexes have prominent horn-like structures called ossicones, which are formed from ossified cartilage, covered in skin and fused to the skull at the parietal bones.[24] Being vascularized, the ossicones may have a role in thermoregulation,[29] and are also used in combat between males.[31] Appearance is a reliable guide to the sex or age of a giraffe: the ossicones of females and young are thin and display tufts of hair on top, whereas those of adult males end in knobs and tend to be bald on top.[24] Also, a median lump, which is more prominent in males, emerges at the front of the skull.[12] Males develop calcium deposits that form bumps on their skulls as they age.[13] A giraffe's skull is lightened by multiple sinuses.[27]:70 However, as males age, their skulls become heavier and more club-like, helping them become more dominant in combat.[24] The upper jaw has a grooved palate and lacks front teeth.[28]:26 The giraffe's molars have a rough surface.[28]:27

Legs, locomotion and posture [edit]

The front and back legs of a giraffe are about the same length. The radius and ulna of the front legs are articulated by the carpus, which, while structurally equivalent to the human wrist, functions as a knee.[32] The foot of the giraffe reaches a diameter of 30 cm (12 in), and the hoof is 15 cm (5.9 in) high in males and 10 cm (3.9 in) in females.[28]:36 The rear of each hoof is low and the fetlock is close to the ground, allowing the foot to support the animal's weight.[12] Giraffes lack dewclaws and interdigital glands. The giraffe's pelvis, though relatively short, has an ilium that is outspread at the upper ends.[12]

A giraffe has only two gaits: walking and galloping. Walking is done by moving the legs on one side of the body at the same time, then doing the same on the other side.[24] When galloping, the hind legs move around the front legs before the latter move forward,[13] and the tail will curl up.[24] The animal relies on the forward and backward motions of its head and neck to maintain balance and the counter momentum while galloping.[8]:327–29 The giraffe can reach a sprint speed of up to 60 km/h (37 mph),[33] and can sustain 50 km/h (31 mph) for several kilometers.[34]

A giraffe rests by lying with its body on top of its folded legs.[8]:329 To lie down, the animal kneels on its front legs and then lowers the rest of its body. To get back up, it first gets on its knees and spreads its hind legs to raise its hindquarters. It then straightens its front legs. With each step, the animal swings its head.[28]:31 In captivity, the giraffe sleeps intermittently around 4.6 hours per day, mostly at night.[35] It usually sleeps lying down, however, standing sleeps have been recorded, particularly in older individuals. Intermittent short "deep sleep" phases while lying are characterized by the giraffe bending its neck backwards and resting its head on the hip or thigh, a position believed to indicate paradoxical sleep.[35] If the giraffe wants to bend down to drink, it either spreads its front legs or bends its knees.[24] Giraffes would probably not be competent swimmers as their long legs would be highly cumbersome in the water,[36] although they could possibly float.[37] When swimming, the thorax would be weighed down by the front legs, making it difficult for the animal to move its neck and legs in harmony[36][37] or keep its head above the surface.[36]

Neck [edit]

An adult male giraffe feeding high up on an acacia

The giraffe has an extremely elongated neck, which can be up to 2 m (6 ft 7 in) in length, accounting for much of the animal's vertical height.[28]:29 The long neck results from a disproportionate lengthening of the cervical vertebrae, not from the addition of more vertebrae. Each cervical vertebra is over 28 cm (11 in) long.[27]:71 They comprise 52–54 percent of the length of the giraffe's vertebral column, compared with the 27–33 percent typical of similar large ungulates, including the giraffe’s closest living relative, the okapi.[11] This elongation largely takes place after birth, as giraffe mothers would have a difficult time giving birth to young with the same neck proportions as adults.[38] The giraffe's head and neck are held up by large muscles and a nuchal ligament, which are anchored by long dorsal spines on the anterior thoracic vertebrae, giving the animal a hump.[12]

The giraffe's neck vertebrae have ball and socket joints.[27]:71 In particular, the atlasaxis joint (C1 and C2) allows the animal to tilt its head vertically and reach more branches with the tongue.[28]:29 The point of articulation between the cervical and thoracic vertebrae of giraffes is shifted to lie between the first and second thoracic vertebrae (T1 and T2), unlike most other ruminants where the articulation is between the seventh cervical vertebra (C7) and T1.[11][38] This allows C7 to contribute directly to increased neck length and has given rise to the suggestion that T1 is actually C8, and that giraffes have added an extra cervical vertebra.[39] However, this proposition is not generally accepted, as T1 has other morphological features, such as an articulating rib, deemed diagnostic of thoracic vertebrae, and because exceptions to the mammalian limit of seven cervical vertebrae are generally characterized by increased neurological anomalies and maladies.[11]

There are two main hypotheses regarding the evolutionary origin and maintenance of elongation in giraffe necks.[31] The "competing browsers hypothesis" was originally suggested by Charles Darwin and only challenged recently. It suggests that competitive pressure from smaller browsers, such as kudu, steenbok and impala, encouraged the elongation of the neck, as it enabled giraffes to reach food that competitors could not. This advantage is real, as giraffes can and do feed up to 4.5 m (15 ft) high, while even quite large competitors, such as kudu, can only feed up to about 2 m (6 ft 7 in) high.[40] There is also research suggesting that browsing competition is intense at lower levels, and giraffes feed more efficiently (gaining more leaf biomass with each mouthful) high in the canopy.[41][42] However, scientists disagree about just how much time giraffes spend feeding at levels beyond the reach of other browsers,[10][31][40][43] and a 2010 study found that adult giraffes with longer necks actually suffered higher mortality rates under drought conditions than their shorter-necked counterparts. This study suggests that maintaining a longer neck requires more nutrients, which puts longer-necked giraffes at risk during a food shortage.[44]

The other main theory, the sexual selection hypothesis, proposes that the long necks evolved as a secondary sexual characteristic, giving males an advantage in "necking" contests (see below) to establish dominance and obtain access to sexually receptive females.[10] In support of this theory, necks are longer and heavier for males than females of the same age,[10][31] and the former do not employ other forms of combat.[10] However, one objection is that it fails to explain why female giraffes also have long necks.[45]

Internal systems [edit]

Giraffe bending down to drink. The animal's rete mirabile prevents excess blood flow to the brain when the neck is lowered.

In mammals, the left recurrent laryngeal nerve is longer than the right; in the giraffe it is over 30 cm (12 in) longer. These nerves are longer in the giraffe than in any other living animal;[46] the left nerve is over 2 m (6 ft 7 in) long.[47] Each nerve cell in this path begins in the brainstem and passes down the neck along the vagus nerve, then branches off into the recurrent laryngeal nerve which passes back up the neck to the larynx. Thus, these nerve cells have a length of nearly 5 m (16 ft) in the largest giraffes.[46] The structure of a giraffe's brain resembles that of domestic cattle.[28]:31 The shape of the skeleton gives the giraffe a small lung volume relative to its mass.[48] Its long neck gives it a large amount of dead space, in spite of its narrow windpipe. These factors increase the resistance to airflow. Nevertheless, the animal can still supply enough oxygen to its tissues.[48]

The giraffe's mouth while drinking

The circulatory system of the giraffe has several adaptations for its great height. Its heart, which can weigh more than 25 lb (11 kg) and measures about 2 ft (61 cm) long, must generate approximately double the blood pressure required for a human to maintain blood flow to the brain.[13] Giraffes have unusually high heart rates for their size, at 150 beats per minute.[27]:76 In the upper neck, the rete mirabile prevents excess blood flow to the brain when the giraffe lowers its head.[15] The jugular veins also contain several (most commonly seven) valves to prevent blood flowing back into the head from the inferior vena cava and right atrium while the head is lowered.[49] Conversely, the blood vessels in the lower legs are under great pressure (because of the weight of fluid pressing down on them). To solve this problem, the skin of the lower legs is thick and tight; preventing too much blood from pouring into them.[15]

Giraffes have oesophageal muscles that are unusually strong to allow regurgitation of food from the stomach up the neck and into the mouth for rumination.[27]:78 They have four chambered stomachs, as in all ruminants, and the first chamber has adapted to their specialized diet.[12] The giraffe's intestines measure up to 80 m (260 ft) in length[12] and have a relatively small ratio of small to large intestine.[50] The liver of the giraffe is small and compact.[27]:76 A gallbladder is generally present during fetal life, but it may disappear before birth.[12][51][52]

Behavior and ecology [edit]

Habitat and feeding [edit]

Giraffe extending its tongue to feed. Its tongue, lips and palate are tough enough to deal with sharp thorns in trees.

Giraffes usually inhabit savannas, grasslands and open woodlands. They prefer Acacia, Commiphora, Combretum and open Terminalia woodlands over denser environments like Brachystegia woodlands.[8]:322 The Angolan giraffe can be found in desert environments.[53] Giraffes browse on the twigs of trees, preferring trees of genera Acacia, Commiphora and Terminalia,[4] which are important sources of calcium and protein to sustain the giraffe's growth rate.[9] They also feed on shrubs, grass and fruit.[8]:324 A giraffe eats around 34 kg (75 lb) of foliage daily.[24] When stressed, giraffes may chew the bark off branches. Although herbivorous, the giraffe has been known to visit carcasses and lick dried meat off bones.[8]:325

During the wet season, food is abundant and giraffes are more spread out, while during the dry season, they gather around the remaining evergreen trees and bushes.[4] Mothers tend to feed in open areas, presumably to make it easier to detect predators, although this may reduce their feeding efficiency.[43] As a ruminant, the giraffe first chews its food, then swallows it for processing and then visibly passes the half-digested cud up the neck and back into the mouth to chew again.[27]:78-79 It is common for a giraffe to salivate while feeding.[28]:27 The giraffe requires less food than many other herbivores, because the foliage it eats has more concentrated nutrients and it has a more efficient digestive system.[4] The animal's feces come in the form of small pellets.[12] When it has access to water, a giraffe drinks at intervals no longer than three days.[24]

Giraffes have a great effect on the trees that they feed on, delaying the growth of young trees for some years and giving "waistlines" to trees that are too tall.[24] Feeding is at its highest during the first and last hours of daytime. Between these hours, giraffes mostly stand and ruminate. Rumination is the dominant activity during the night, when it is mostly done lying down.[24]

Male giraffe mounting a female. Only dominant males are generally able to mate.

Social life and breeding habits [edit]

While giraffes are usually found in groups, the composition of these groups tends to be open and ever-changing.[54] They have few strong social bonds, and aggregations usually change members every few hours. For research purposes, a "group" has been defined as "a collection of individuals that are less than a kilometre apart and moving in the same general direction."[55] The number of giraffes in a group can range up to 32 individuals.[54] The most stable giraffe groups are those made of mothers and their young,[55] which can last weeks or months.[56] Social cohesion in these groups is maintained by the bonds formed between calves.[8]:330[55] Mixed-sex groups made of adult females and young males are also known to occur.[55] Subadult males are particularly social and will engage in playfights. However, as they get older males become more solitary.[56] Giraffes are not territorial,[12] but they have home ranges.[24] Male giraffes occasionally wander far from areas that they normally frequent.[8]:329

Although generally quiet and non-vocal, giraffes have been heard to communicate using various sounds. During courtship, males emit loud coughs.[24] Females call their young by bellowing. Calves will emit snorts, bleats, mooing and mewing sounds. Giraffes also snore, hiss, moan and make flute-like sounds,[24] and they communicate over long distances using infrasound.[57]

Reproduction [edit]

Reproduction is broadly polygamous: a few older males mate with the fertile females. Male giraffes assess female fertility by tasting the female's urine to detect estrus, in a multi-step process known as the flehmen response.[55][56] Males prefer young adult females over juveniles and older adults.[55] Once an estrous female is detected, the male will attempt to court her. When courting, dominant males will keep subordinate ones at bay.[56] During copulation, the male stands on its hind legs with its head held up and its front legs resting on the female's sides.[24]

Birthing and parental care [edit]
Mother giraffe and calves feeding. It is mostly the females that raise young, and they may gather in nursery herds.

Giraffe gestation lasts 400–460 days, after which a single calf is normally born, although twins occur on rare occasions.[58] The mother gives birth standing up. The calf emerges head and front legs first, having broken through the fetal membranes, and falls to the ground, severing the umbilical cord.[12] The mother then grooms the newborn and helps it stand up.[28]:40 A newborn giraffe is about 1.8 m (6 ft) tall. Within a few hours of birth, the calf can run around and is almost indistinguishable from a one-week-old. However, for the first 1–3 weeks, it spends most of its time hiding;[59] its coat pattern providing camouflage. The ossicones, which have lain flat while it was in the womb, become erect within a few days.[24]

Mothers with calves will gather in nursery herds, moving or browsing together. Mothers in such a group may sometimes leave their calves with one female while they forage and drink elsewhere. This is known as a "calving pool".[59] Adult males play almost no role in raising the young,[8]:337 although they appear to have friendly interactions.[55] Calves are at risk of predation, and a mother giraffe will stand over her calf and kick at an approaching predator.[24] Females watching calving pools will only alert their own young if they detect a disturbance, although the others will take notice and follow.[59] The bond a mother shares with her calf varies, though it can last until her next calving.[59] Likewise, calves may suckle for only a month[8]:335 or as long as a year.[24][56] Females become sexually mature when they are four years old, while males become mature at four or five years. However, males must wait until they are at least seven years old to gain the opportunity to mate.[24][28]:40

Male giraffes will engage in necking to establish dominance.

Necking [edit]

Male giraffes use their necks as weapons in combat, a behavior known as "necking". Necking is used to establish dominance and males that win necking bouts have greater reproductive success.[10] This behavior occurs at low or high intensity. In low intensity necking, the combatants rub and lean against each other. The male that can hold itself more erect wins the bout.[24] In high intensity necking, the combatants will spread their front legs and swing their necks at each other, attempting to land blows with their ossicones. The contestants will try to dodge each other's blows and then get ready to counter. The power of a blow depends on the weight of the skull and the arc of the swing.[24] A necking duel can last more than half an hour, depending on how well matched the combatants are.[8]:331

After a duel, it is common for two male giraffes to caress and court each other, leading up to mounting and climax. Such interactions between males have been found to be more frequent than heterosexual coupling.[60] In one study, up to 94 percent of observed mounting incidents took place between males. The proportion of same-sex activities varied from 30–75 percent. Only one percent of same-sex mounting incidents occurred between females.[61]

Mortality and health [edit]

Lioness seen with adult giraffe kill

Giraffes have an unusually long lifespan compared to other ruminants,[62] up to 25 years in the wild.[15] Because of their size, eyesight and powerful kicks, adult giraffes are usually not subject to predation.[24] However, they can fall prey to lions and are regular prey for them in Kruger National Park.[63] Nile crocodiles can also be a threat to giraffes when they bend down to drink.[28]:31 Calves are much more vulnerable than adults, and are additionally preyed on by leopards, spotted hyenas and wild dogs.[13] A quarter to a half of giraffe calves reach adulthood.

Some parasites feed on giraffes. They are often hosts for ticks, especially in the area around the genitals, which has thinner skin than other areas.[12] Tick species that commonly feed on giraffes are those of genera Hyalomma, Amblyomma and Rhipicephalus. Giraffes may rely on red-billed and yellow-billed oxpeckers to clean them of ticks and alert them to danger. Giraffes host numerous species of internal parasite and are susceptible to various diseases. They were victims of the (now eradicated) viral illness rinderpest.[12]

Relationship with humans [edit]

Cultural significance [edit]

Bushman rock art in Namibia depicting a giraffe

Humans have interacted with giraffes for millennia. The Bushmen of southern Africa have medicine dances named after some animals; the giraffe dance is performed to treat head ailments.[64] How the giraffe got its height has been the subject of various African folktales,[10] including one from eastern Africa which explains that the giraffe grew tall from eating too many magic herbs.[65] Giraffes were depicted in art throughout the African continent, including that of the Kiffians, Egyptians and Meroë Nubians.[28]:45–47 The Kiffians were responsible for a life-size rock engraving of two giraffes that has been called the "world's largest rock art petroglyph".[28]:45[66] The Egyptians gave the giraffe its own hieroglyph, named 'sr' in Old Egyptian and 'mmy' in later periods.[28]:49 They also kept giraffes as pets and shipped them around the Mediterranean.[28]:48–49

Painting of a giraffe imported to China during the Ming Dynasty

The giraffe was also known to the Greeks and Romans, who believed that it was an unnatural hybrid of a camel and a leopard and called it camelopardalis.[28]:50 The giraffe was among the many animals collected and displayed by the Romans. The first one in Rome was brought in by Julius Caesar in 46 BC and exhibited to the public.[28]:52 With the fall of the Roman Empire, the housing of giraffes in Europe declined.[28]:54 During the Middle Ages, giraffes were only known to Europeans through contact with the Arabs, who revered the giraffe for its peculiar appearance.[13]

In 1414, a giraffe was shipped from Malindi to Bengal. It was then taken to China by explorer Zheng He and placed in a Ming Dynasty zoo. The animal was a source of fascination for the Chinese people, who associated it with the mythical Qilin.[28]:56 The Medici giraffe was a giraffe presented to Lorenzo de' Medici in 1486. It caused a great stir on its arrival in Florence.[67] Another famous giraffe was brought from Egypt to Paris in the early 19th century. A sensation, the giraffe was the subject of numerous memorabilia or "giraffanalia".[28]:81

Giraffes continue to have a presence in modern culture. Salvador Dalí depicted them with conflagrated manes in some of his surrealist paintings. Dali considered the giraffe to be a symbol of masculinity, and a flaming giraffe was meant to be a "masculine cosmic apocalyptic monster".[28]:123 Several children's books feature the giraffe, including David A. Ufer's The Giraffe Who Was Afraid of Heights, Giles Andreae's Giraffes Can't Dance and Roald Dahl's The Giraffe and the Pelly and Me. Giraffes have appeared in animated films, as minor characters in Disney's The Lion King and Dumbo, and in more prominent roles in The Wild and in the Madagascar films. Sophie the Giraffe has been a popular teether since 1961. Another famous fictional giraffe is the Toys "R" Us mascot Geoffrey the Giraffe.[28]:127 The giraffe is also the national animal of Tanzania.[68]

The giraffe has also been used for some scientific experiments and discoveries. Scientists have looked at the properties of giraffe skin when developing suits for astronauts and fighter pilots.[27]:76 This is because the people in these professions are in danger of passing out if blood rushes to their legs. Computer scientists have modeled the coat patterns of several subspecies using reaction–diffusion mechanisms.[69] The constellation of Camelopardalis, introduced in the seventeenth century, depicts a giraffe.[28]:119–20 The Tswana people of Botswana saw the constellation Crux as two giraffes – Acrux and Mimosa forming a male, and Gacrux and Delta Crucis forming the female.[70]

Exploitation and conservation status [edit]

Giraffe killed by tribesmen in the early 20th century

Giraffes were probably common targets for hunters throughout Africa.[8]:337 Different parts of their bodies were used for different purposes.[12] Their meat was used for food. The tail hairs served as flyswatters, bracelets, necklaces and thread.[8]:337[12] Shields, sandals and drums were made using the skin, and the strings of musical instruments were from the tendons.[12] The smoke from burning giraffe skins was used by the medicine men of Buganda to treat nose bleeds.[8]:337 In the 19th Century, European explorers began to hunt them for sport.[28]:129 Habitat destruction has hurt the giraffe, too: in the Sahel, the need for firewood and grazing room for livestock has led to deforestation. Normally, giraffes can coexist with livestock, since they do not directly compete with them.[15]

The giraffe species as a whole is assessed as Least Concern from a conservation perspective by the IUCN, as it is still numerous. However, giraffes have been extirpated from much of their historic range including Eritrea, Guinea, Mauritania and Senegal. They may also have disappeared from Angola, Mali, and Nigeria, but have been introduced to Rwanda and Swaziland.[2] Two subspecies, the West African giraffe and the Rothschild giraffe, have been classified as Endangered,[22][23] as wild populations of each of them number in the hundreds.[16] In 1997, Jonathan Kingdon suggested that the Nubian giraffe was the most threatened of all giraffes;[4] as of 2010, it may number fewer than 250, although this estimate is uncertain.[16] Private game reserves have contributed to the preservation of giraffe populations in southern Africa.[15] Giraffe Manor is a popular hotel in Nairobi that also serves as sanctuary for Rothschild's giraffes.[71] The giraffe is a protected species in most of its range. In 1999, it was estimated that over 140,000 giraffes existed in the wild, but estimates in 2010 indicate that fewer than 80,000 remain.[16]

References [edit]

  1. ^ Grubb, P. (2005). "Giraffa camelopardalis". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 672. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b c d Fennessy, J.; Brown, D. (2010). "Giraffa camelopardalis". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 2013-01-26. 
  3. ^ a b c d "Giraffe". Online Etymology Dictionary. Retrieved 2011-11-01. 
  4. ^ a b c d e Kingdon, J. (1997). The Kingdon Field Guide to African Mammals. Academic Press. pp. 339–44. ISBN 0-12-408355-2. 
  5. ^ Peust, C. (2009). "Some Cushitic Etymologies". In Dolgopolʹskiĭ, A.; Takács, G.; Jungraithmayr, H. Semito-Hamitic Festschrift for A.B. Dolgopolsky and H. Jungraithmayr. Reimer. pp. 257–60. ISBN 3-496-02810-6. 
  6. ^ "camelopardalis". A Latin Dictionary, Perseus Digital Library. Retrieved 2011-11-23. 
  7. ^ a b Walker, C. (1997). Signs of the Wild. Struik. p. 142. ISBN 1-86825-896-3. 
  8. ^ a b c d e f g h i j k l m n o p Kingdon, J. (1988). East African Mammals: An Atlas of Evolution in Africa, Volume 3, Part B: Large Mammals. University Of Chicago Press. pp. 313–37. ISBN 0-226-43722-1. 
  9. ^ a b c d e f g Mitchell, G.; Skinner, J. D. (2003). "On the origin, evolution and phylogeny of giraffes Giraffa camelopardalis". Transactions of the Royal Society of South Africa 58 (1): 51–73. doi:10.1080/00359190309519935. 
  10. ^ a b c d e f g Simmons, R. E.; Scheepers, L. (1996). "Winning by a Neck: Sexual Selection in the Evolution of Giraffe". The American Naturalist 148 (5): 771–86. doi:10.1086/285955. 
  11. ^ a b c d Badlangana, L. N.; Adams, J. W.; Manger P. R. (2009). "The giraffe (Giraffa camelopardalis) cervical vertebral column: A heuristic example in understanding evolutionary processes?". Zoological Journal of the Linnean Society 155 (3): 736–57. doi:10.1111/j.1096-3642.2008.00458.x. 
  12. ^ a b c d e f g h i j k l m n o p q r s Dagg, A. I. (1971). "Giraffa camelopardalis". Mammalian Species 5 (5): 1–8. doi:10.2307/3503830. 
  13. ^ a b c d e f g h i j Prothero, D. R.; Schoch, R. M. (2003). Horns, Tusks, and Flippers: The Evolution of Hoofed Mammals. Johns Hopkins University Press. pp. 67–72. ISBN 0-8018-7135-2. 
  14. ^ a b c Brown, D. M.; Brenneman R. A.; Koepfli, K-P.; Pollinger, J. P.; Milá, B.; Georgiadis, N. J.; Louis Jr., E. E.; Grether, G. F.; Jacobs, D. K.; Wayne R. K. (2007). "Extensive population genetic structure in the giraffe". BMC Biology 5 (1): 57. doi:10.1186/1741-7007-5-57. PMC 2254591. PMID 18154651. 
  15. ^ a b c d e f g h i j k l m n o Pellow, R. A. (2001). "Giraffe and Okapi". In MacDonald, D. The Encyclopedia of Mammals (2nd ed.). Oxford University Press. pp. 520–27. ISBN 0-7607-1969-1. 
  16. ^ a b c d e f g h i j k l "Giraffe – The Facts: Current giraffe status?". Giraffe Conservation Foundation. Retrieved 2010-12-21. 
  17. ^ "Exhibits". Al Ain Zoo. 2003-02-25. Retrieved 2011-11-21. 
  18. ^ "Nubian giraffe born in Al Ain zoo". UAE Interact. Retrieved 2010-12-21. 
  19. ^ a b c d e f g "Giraffa". ISIS. 2010. Retrieved 2010-11-04. 
  20. ^ Brenneman, R. A.; Louis, E. E. Jr; Fennessy, J. (2009). "Genetic structure of two populations of the Namibian giraffe, Giraffa camelopardalis angolensis". African Journal of Ecology 47 (4): 720–28. doi:10.1111/j.1365-2028.2009.01078.x. 
  21. ^ a b c d e Hassanin, A.; Ropiquet, A.; Gourmand, B-L.; Chardonnet, B.; Rigoulet, J. (2007). "Mitochondrial DNA variability in Giraffa camelopardalis: consequences for taxonomy, phylogeography and conservation of giraffes in West and central Africa". Comptes Rendus Biologies 330 (3): 173–83. doi:10.1016/j.crvi.2007.02.008. PMID 17434121. 
  22. ^ a b Fennessy, J. & Brenneman, R. (2010). "Giraffa camelopardalis ssp. rothschildi". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 2013-01-26. 
  23. ^ a b Fennessy, J.; Brown, D. (2008). "Giraffa camelopardalis ssp. peralta". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 2013-01-26. 
  24. ^ a b c d e f g h i j k l m n o p q r s t u v w x Estes, R. (1992). The Behavior Guide to African Mammals: including Hoofed Mammals, Carnivores, Primates. University of California Press. pp. 202–07. ISBN 0-520-08085-8. 
  25. ^ Lever, A-M. (2007-12-21). "Not one but 'six giraffe species'". BBC News. Retrieved 2009-03-04. 
  26. ^ a b Skinner, J. D.; Smithers, R. H. M. (1990). The mammals of the southern African subregion. University of Pretoria. pp. 616–20. ISBN 0-521-84418-5. 
  27. ^ a b c d e f g h i Swaby, S. (2010). "Giraffe". In Harris, T. Mammal Anatomy: An Illustrated Guide. Marshall Cavendish Corporation. pp. 64–84. ISBN 0-7614-7882-5. 
  28. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa ab ac ad Williams, E. (2011). Giraffe. Reaktion Books. ISBN 1-86189-764-2. 
  29. ^ a b Mitchell, G.; Skinner, J.D. (2004). "Giraffe thermoregulation: a review". Transactions of the Royal Society of South Africa: Proceedings of a Colloquium on Adaptations in Desert Fauna and Flora 59 (2): 49–57. doi:10.1080/00359190409519170. ISSN 0035-919X. 
  30. ^ Wood, W. F.; Weldon, P. J. (2002). "The scent of the reticulated giraffe (Giraffa camelopardalis reticulata)". Biochemical Systematics and Ecology 30 (10): 913–17. doi:10.1016/S0305-1978(02)00037-6. 
  31. ^ a b c d Simmons, R. E.; Altwegg, R. (2010). "Necks-for-sex or competing browsers? A critique of ideas on the evolution of giraffe". Journal of Zoology 282 (1): 6–12. doi:10.1111/j.1469-7998.2010.00711.x. 
  32. ^ MacClintock, D.; Mochi, U. (1973). A natural history of giraffes. Scribner. p. 30. ISBN 0-684-13239-7. 
  33. ^ Garland, T; Janis, C. M. (1993). "Does metatarsal/femur ratio predict maximal running speed in cursorial mammals?". Journal of Zoology 229 (1): 133–51. doi:10.1111/j.1469-7998.1993.tb02626.x. 
  34. ^ Rafferty, John. P (2011). Grazers (Britannica Guide to Predators and Prey). Britannica Educational Publishing. p. 194. ISBN 1-61530-336-7 
  35. ^ a b Tobler, I.; Schwierin, B., I.; Schwierin, B. (1996). "Behavioural sleep in the giraffe (Giraffa camelopardalis) in a zoological garden". Journal of Sleep Research 5 (1): 21–32. doi:10.1046/j.1365-2869.1996.00010.x. PMID 8795798. 
  36. ^ a b c Henderson, D. M.; Naish, D. (2010). "Predicting the buoyancy, equilibrium and potential swimming ability of giraffes by computational analysis". Journal of Theoretical Biology 265 (2): 151–59. doi:10.1016/j.jtbi.2010.04.007. PMID 20385144. 
  37. ^ a b Naish, D. (January 2011). "Will it Float?". Scientific American 304 (1): 22. ISSN 0036-8733. 
  38. ^ a b Van Sittert, S. J.; Skinner, J. D.; Mitchell, G. (2010). "From fetus to adult – An allometric analysis of the giraffe vertebral column". Journal of Experimental Zoology Part B Molecular and Developmental Evolution 314B (6): 469–79. doi:10.1002/jez.b.21353. 
  39. ^ Solounias, N. (1999). "The remarkable anatomy of the giraffe's neck". Journal of Zoology 247 (2): 257–68. doi:10.1111/j.1469-7998.1999.tb00989.x. 
  40. ^ a b du Toit, J. T. (1990). "Feeding-height stratification among African browsing ruminants". African Journal of Ecology 28 (1): 55–62. doi:10.1111/j.1365-2028.1990.tb01136.x. 
  41. ^ Cameron, E. Z.; du Toit, J. T. (2007). "Winning by a Neck: Tall Giraffes Avoid Competing with Shorter Browsers". American Naturalist 169 (1): 130–35. doi:10.1086/509940. PMID 17206591. 
  42. ^ Woolnough, A. P.; du Toit, J. T. (2001). "Vertical zonation of browse quality in tree canopies exposed to a size-structured guild of African browsing ungulates". Oecologia 129 (1): 585–90. doi:10.1007/s004420100771. 
  43. ^ a b Young, T. P.; Isbell, L. A. (1991). "Sex differences in giraffe feeding ecology: energetic and social constraints". Ethology 87 (1–2): 79–89. doi:10.1007/s004420100771. 
  44. ^ Mitchell, G.; van Sittert, S.; Skinner, J. D. (2010). "The demography of giraffe deaths in a drought". Transactions of the Royal Society of South Africa 65 (3): 165–68. doi:10.1080/0035919X.2010.509153. 
  45. ^ Mitchell, G.; van Sittert, S. J.; Skinner, J. D. (2009). "Sexual selection is not the origin of long necks in giraffes". Journal of Zoology 278 (4): 281–86. doi:10.1111/j.1469-7998.2009.00573.x. 
  46. ^ a b Wedel, M. J. (2012). "A monument of inefficiency: the presumed course of the recurrent laryngeal nerve in sauropod dinosaurs". Acta Palaeontologica Polonica 57 (2): 251–56. doi:10.4202/app.2011.0019. 
  47. ^ Harrison, D. F. N. (1995). The Anatomy and Physiology of the Mammalian Larynx. Cambridge University Press. p. 165. ISBN 0-521-45321-6. 
  48. ^ a b Skinner, J. D.; Mitchell, G. (2011). "Lung volumes in giraffes, Giraffa camelopardalis". Comparative Biochemistry and Physiology – Part A: Molecular & Integrative Physiology 158 (1): 72–78. doi:10.1016/j.cbpa.2010.09.003. 
  49. ^ Mitchell, G.; van Sittert, S. J.; Skinner, J. D. (2009). "The structure and function of giraffe jugular vein valves". South African Journal of Wildlife Research 39 (2): 175–80. doi:10.3957/056.039.0210. 
  50. ^ Pérez, W.; Lima, M.; Clauss, M. (2009). "Gross anatomy of the intestine in the giraffe (Giraffa camelopardalis)". Anatomia, Histologia, Embryologia 38 (6): 432–35. doi:10.1111/j.1439-0264.2009.00965.x. PMID 19681830. 
  51. ^ Cave, A. J. E. (1950). "On the liver and gall-bladder of the Giraffe". Proceedings of the Zoological Society of London 120 (2): 381–93. doi:10.1111/j.1096-3642.1950.tb00956.x. 
  52. ^ Oldham-Ott, Carla K.; Gilloteaux, Jacques (1997). "Comparative morphology of the gallbladder and biliary tract in vertebrates: variation in structure, homology in function and gallstones". Microscopy Research and Technique 38 (6): 571–79. doi:10.1002/(SICI)1097-0029(19970915)38:6<571::AID-JEMT3>3.0.CO;2-I. 
  53. ^ Fennessy, J. (2004). Ecology of desert-dwelling giraffe Giraffa camelopardalis angolensis in northwestern Namibia (Ph.D. thesis). University of Sydney. http://ses.library.usyd.edu.au/handle/2123/910.
  54. ^ a b van der Jeugd, H. P; Prins, H. H. T. (2000). "Movements and group structure of giraffe (Giraffa camelopardalis) in Lake Manyara National Park, Tanzania". Journal of Zoology 251 (1): 15–21. doi:10.1111/j.1469-7998.2000.tb00588.x. 
  55. ^ a b c d e f g Pratt D. M.; Anderson V. H. (1985). "Giraffe social behavior". Journal of Natural History 19 (4): 771–81. doi:10.1080/00222938500770471. 
  56. ^ a b c d e Leuthold, B. M. (1979). "Social organization and behaviour of giraffe in Tsavo East National Park". African Journal of Ecology 17 (1): 19–34. doi:10.1111/j.1365-2028.1979.tb00453.x. 
  57. ^ "Silent Sentinels?". PBS online – Nature. Retrieved 2011-12-21. 
  58. ^ "Mammal Guide – Giraffe". Animal Planet. Retrieved 2009-03-07. 
  59. ^ a b c d Langman, V. A. (1977). "Cow-calf relationships in giraffe (Giraffa camelopardalis giraffa)". Zeitschrift fur Tierpsychologie 43 (3): 264–86.  doi:10.1111/j.1439-0310.1977.tb00074.x
  60. ^ Coe, M. J. (1967). "'Necking' behavior in the giraffe". Journal of Zoology 151 (2): 313–21. doi:10.1111/j.1469-7998.1967.tb02117.x. 
  61. ^ Bagemihl, B. (1999). Biological Exuberance: Animal Homosexuality and Natural Diversity. St. Martin's Press. pp. 391–93. ISBN 0-312-19239-8. 
  62. ^ Müller, D.W.; Zerbe, P; Codron, D; Clauss, M; Hatt, J.M. (2011). "A long life among ruminants: giraffids and other special cases". Schweizer Archiv für Tierheilkunde 153 (11): 515–519. doi:10.1024/0036-7281/a000263. PMID 22045457. 
  63. ^ Owen-Smith, N.; Mills, M. G. (2008). "Predator-prey size relationships in an African large-mammal food web". Journal of Animal Ecology 77 (1): 173–83. doi:10.1111/j.1365-2656.2007.01314.x. PMID 18177336. 
  64. ^ Ross, K. (2003). Okavango: jewel of the Kalahari. Struik. p. 168. ISBN 1-86872-729-7. 
  65. ^ Greaves, N.; Clement, R. (2000). When Hippo Was Hairy: And Other Tales from Africa. Struik. pp. 86–88. ISBN 1-86872-456-5. 
  66. ^ "The Dabous Giraffe rock art petrograph". The Bradshaw Foundation. Retrieved 2011-11-06. 
  67. ^ Ringmar, E. (2006). "Audience for a Giraffe: European Expansionism and the Quest for the Exotic". Journal of World History 17 (4): 353–97. doi:10.1353/jwh.2006.0060. JSTOR 20079397. 
  68. ^ Knappert, J (1987). East Africa: Kenya, Tanzania & Uganda. Vikas Publishing House. p. 57. ISBN 0-7069-2822-9. 
  69. ^ Walter, M.; Fournier, A.; Menevaux, D. (2001). "Integrating shape and pattern in mammalian models in SIGGRAPH '01". Proceedings of the 28th annual conference on Computer graphics and interactive techniques: 317–26. doi:10.1145/383259.383294. ISBN 1-58113-374-X. 
  70. ^ Clegg, A. (1986). "Some Aspects of Tswana Cosmology". Botswana Notes and Records 18: 33–37. JSTOR 40979758. 
  71. ^ Lord. M (2012-01-11). "Outlandish Outposts: Giraffe Manor in Kenya". Forbes.com. Retrieved 2012-04-04. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!