Physical Description

Morphology

"Disc: Up to 27 mm in diameter, pentagonal with flat, overlapping scales. The radial shields are almost pentagonal, longer than their width and about one-fifth the diameter of the disc; they are separated proximally by a wedge of scales scales and distally by a continuation of the dorsal arm plates. The arm combs consist of ten flat, squarish scales in tight contact with each other throughout their length.

Arms: About five to six times as long as the disc diameter. The dorsal arm plates overlap and are fan-shaped with a median ridge. The three arm spines each taper to a sharp tip; the upper spines at the base of the arm are equal to 1.5 joints in lenth and the others become shorter distally. The first ventral arm plate is triangular with a median groove, and the others are twice as wide as their length. Each podial pore has a small, bluntly pointed tentacle scale; large individuals have a second scale on the ventral arm plate.

Mouth: About ten spine-like apical oral papillae form a cluster around the mouth; each side of the jaw has five flat lateral oral papillae opposed by the three pointed papillae on the first ventral arm plate. The oral shield is a large, rounded pentagon, deeply notched on the sides. The adoral shields are narrow.

Colour: The dorsal disc surface varies but is usually mottled brown or grey. The arms often have brown or grey bands; they are white underneath. The arm spines are brown or grey at the base with white tips." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 153 specimens in 1 taxon.
Water temperature and chemistry ranges based on 39 samples.

Environmental ranges
  Depth range (m): 0 - 4045.5
  Temperature range (°C): 1.497 - 12.849
  Nitrate (umol/L): 6.725 - 38.338
  Salinity (PPS): 31.803 - 34.684
  Oxygen (ml/l): 2.778 - 6.561
  Phosphate (umol/l): 0.943 - 2.705
  Silicate (umol/l): 9.297 - 178.329

Graphical representation

Depth range (m): 0 - 4045.5

Temperature range (°C): 1.497 - 12.849

Nitrate (umol/L): 6.725 - 38.338

Salinity (PPS): 31.803 - 34.684

Oxygen (ml/l): 2.778 - 6.561

Phosphate (umol/l): 0.943 - 2.705

Silicate (umol/l): 9.297 - 178.329
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Common on or just below the surface of silty sand or gravel substrata. Populations may be so dense that neighbours; arm tips overlap. Contact with one individual ay initiate waving of the arms throughout the population." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

"Limited to benthic organisms and carrion. Ophiura luetkenii can detect food from a distance and rapidly approach it using rowing motions of the arms. It captures food by quickly encircling it with an arm. It brings the arm loop to the jaws, which open and close as the food is pushed in by the oral tube feet. The jaws grip large pieces of flesh while the arms push it away to tear pieces off." (Lambert, Austin 2007)

Public Domain

Browne, Joy

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ophiura luetkenii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCCTATATCTTATATTTGGTGCATGGGCCGGAACTGTAGGAACAGCCATGAGAAATATTATCCGGGTAGAGTTATCACAACCAGGATCCTTAATCCAAAAAGATCAAACATATAACGTTATAGTGACAGCACATGCCTTTATTATGATTTTCTTTATGGTAATGCCCATTATGATTGGAGGATTTGGTAATTGGTTAGTACCACTAATGATTGGGGCTCCCGATATGGCCTTTCCTCGAATGAAAAAAATGAGATTCTGATTAATCCCTCCTTCTTTTTTATTATTAATAGCCTCAGCAGGTAAAGAAAGGGGAGTGGGGACCGGATGAACAGTTTACCCCCCCTTATCCGGACCCGTTGCCCATGCAGGAGGATGTGTAGATTTAGCAATTTTTTCTCTACACTTGGCAGGAGCTTCATCAATTATGGCATCTATTAATTTTATAACAACCATAATTAATATGCGAGCACCTGGAATGTCAATGGACCGAACTCCTCTATTTGTGTGATCAATTTTAATTACAACATTCCTCCTATTATTATCTTTACCTGTTTTAGCTGGAGCCATTACTATGCTATTAACTGACCGCAATATTAAAACTTCTTTCTTTGACCCAACCGGAGGAGGGGACCCAATTTTATTCCAACACCTGTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ophiura luetkenii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!