Overview

Comprehensive Description

Description

 The shell of the chequered carpet shell is broadly oval or square in shape and is cream, yellowish, or light brown in colour, often with darker markings. The sculpture of the shell consists of concentric grooves and bold radiating ridges. There are quite distinct criss-cross (decussate) markings present posteriorly. When the valves are closed, below the beak there is a shallow, not particularly distinct, heart-shaped depression with light and dark brown fine radiating ridges. The beaks of one half of the valve are broadly oval in outline, with the line descending from the beak sharply curved; whilst the other side of the beak gradually curves. It can grow up to 7.5 cm in length. Each valve has three teeth, one on the left and two on the right which are bifid. The inside of the shell is polished white with an orange tint, occasionally with purple over a wide area below the umbones. The pallial line is u-shaped but does not extend beyond the mid-line of the shell.The chequered carpet shell is superficially similar in shape and size to the Manila clam Tapes philippinarum and to Venerupis senegalensis. The chequered carpet shell is distinguishable from the Manila clam by its very distinct radiating lines present on the shell and white foot, Tapes philippinarum is distinguishable by the distinctive black and white markings and orange foot. Venerupis senegalensis often has zigzag markings on the shell.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Belgian Exclusive Economic Zone, Irish Exclusive economic Zone, Mellah lagoon, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Original description, by Linnaeus (1758, p. 690):
"V. testa ovata antice angulata decussatim striata. M. L. U.
Habitat in
O. Indico.
Testae Anus minimus, retusus, macula nulla impressa. Color intus albidus, saepius cum tinctura crocea."

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sartori, André F.

Source: Molluscs - eBivalvia LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 3.5
  Temperature range (°C): 11.768 - 11.768
  Nitrate (umol/L): 7.121 - 7.121
  Salinity (PPS): 35.334 - 35.334
  Oxygen (ml/l): 6.069 - 6.069
  Phosphate (umol/l): 0.439 - 0.439
  Silicate (umol/l): 2.489 - 2.489

Graphical representation

Depth range (m): 0 - 3.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 This species tends to bury itself in sand, muddy gravel, or clay and is found on the lower shore and shallow sublittoral.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Venerupis decussata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Venerupis decussatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATACTTTATCTTTTCTTTCTGAGCTGGTTTGATAGGAACAGGTTTTAGAGTAATTATTCGGATAGAGTTAGCTATACCAGGAAAAGTGTTGATGGAC---GGTCACTTATATAACTTAATTGTGACTGCTCATGGGTTAGTGATGATTTTCTTTTTAGTAATACCTATAATGATTGGGGGTTTCGGTAACTGGTTGGTTCCCTTAATGTTGGTAATTCCTGATATGGCATTCCCTCGTATAAATAATGCTAGATTTTGGTTTTTACCTGTTTCTATGATGTTGTTATTAGGTTCAACATATGTTGATAATGGTGCGGGTAGTGGGTGGACTATCTATCCACCACTGTCTAGTGGTTTAGGGCACCCGGGATGCGCTATGGATTACGTTATTCTTTCTCTTCACGTGGGTGGAGCATCCTCTATTATGGCTTCTATTAACTTTTTAATTACAAGTTTGACGATACGTACTGGGGTGATAAACATGCTTCGTACAAGAATATTTGTATGGTGCATCGCTGTAACGTCCTTTCTGTTGATTTTGGCTATGCCTGTATTAGCAGGGGCTTTAACAATGTTGTTAACGGACCGAAACTTTAATACTAGGTTTTTTGACCCGACGGGGTTGGGGGATCCTATTTTATTCGTTCATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Venerupis decussatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ruditapes decussatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Venerupis decussata

Venerupis decussata is a marine bivalve mollusc in the family Veneridae, commonly known as the cross-cut carpet shell.

Contents

Taxonomy

The species name Venerupis decussata (Linnaeus, 1758) is considered valid by the World Register of Marine Species (WoRMS) with a range limited to the north east Atlantic Ocean.[1] The Integrated Taxonomic Identification System (ITIS) also accepts the name as valid and states that it has a synonym, Tapes decussata.[2] WoRMS accepts as valid the name of another species, Ruditapes decussatus (Linnaeus, 1758), a species with a world-wide distribution. It states that among the synonyms of this species are Tapes decussata (Linnaeus, 1758) and Tapes (Ruditapes) decussatus (Linnaeus, 1758).[3]

Description

The shell of Venerupis decussata is robust and can grow to a length of 75mm (3in). Each valve is broadly oval or rhomboidal, with the umbones set towards the anterior end. The posterior hinge line is straight and the posterior margin truncate. The anterior hinge line slopes slightly down towards the more steeply sloping anterior margin. There are three cardinal teeth on each valve, the central one on the left valve and the posterior two on the right valve being bifid (having two points). The sculpture on the shell is bold, with both concentric ridges and radiating rays. The annual growth lines can be seen clearly. The general colour is creamy white and there are sometimes faint purplish radial bands. The interior is glossy white sometimes with a yellow tinge and often a bluish shading near the hinge. The adductor muscle scars and the pallial line are distinct, the latter having a distinctive U-shaped pallial sinus extending half way across the valve.[4] The animal itself is pale grey or cream coloured with the mantle fringed with white. The siphons are separate for all their length and have brownish tips where they reach the surface.[4]

Distribution

The range of Venerupis decussata extends from the North Sea and British Isles southwards to the Mediterranean Sea and north Africa. It is found buried in soft substrates, sand, muddy sand, gravel or clay, on the lower shore and at depths down to a few metres in the intertidal zone.[4]

References

  1. ^ a b Venerupis decussata (Linnaeus, 1758) World Register of Marine Species. Retrieved 2011-09-30.
  2. ^ Venerupis decussata Linnaeus, 1758 Integrated Taxonomic Identification System. Retrieved 2011-09-30.
  3. ^ Ruditapes decussatus (Linnaeus, 1758) World Register of Marine Species. Retrieved 2011-09-30.
  4. ^ a b c Tapes decussata Marine Species Identification Portal. Retrieved 2011-09-30.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Grooved carpet shell

The grooved carpet shell, Ruditapes decussatus, is a clam or bivalve mollusc in the family Veneridae. It is distributed worldwide and due to its ecological and economic interest has been proposed as a bioindicator.

This species is one of the most popular and profitable mollusc of lagoonal and coastal sites in the Mediterranean, where it was collected for a long time as food. It is consumed fresh and canned.

Contents

Description

The shell is broadly oval to quadrate with the umbones distinctly anterior. The posterior hinge line is straight, the posterior margin truncate, and the anterior hinge line grades into the down-sloping anterior margin. It is prominent posteriorly, where the shell is conspicuously decussate. The surface has a sculpture of fine concentric striae and bolder radiating lines. Growth stages are clear. The lunule and escutcheon are poorly defined. Each valve has three cardinal teeth: the centre one in the left valve, and centre and posterior in right are bifid. The pallial line and adductor scars are distinct. The pallial sinus is U-shaped, not extending beyond the midline of the shell, but reaching a point below the posterior part of the ligament. The lower limb of the sinus is distinct from the pallial line for the whole of its length. The inner surfaces of the shell are glossy white, often with yellow or orange tints, and with a bluish tinge along the dorsal edge. The overall color is cream, yellowish, or light brown, often with darker markings.[2]

Location

Despite improper management, some regions in the Atlantic coast of the Iberian Peninsula, and of the Mediterranean basin, as well as Ireland, currently have solid populations of Ruditapes decussatus.[2] [3] [4]

Uses

Ruditapes decussatus is cultured from the Atlantic coast of France, Spain, Portugal and in the Mediterranean basin. It is often grown with other bivalves (Venerupis pullastra, Venerupis rhomboideus, Venerupis aurea, Dosinia exoleta and Tellina incarnate). Their main predators are shore crabs (Carcinus maenas); starfish (Asterias rubens and Marthasterias glaciais); gastropods (Natica sp.); and birds (Larus sp). An individual Carcinus maenas (6.5 cm width) can consume 5 or 6 clams per day. Marine aquaculture production of grooved carpet shell in 2003 was 3,007 t in Portugal, which excludes non-aquaculture harvesting of the species.

Between 1997 and 2001 total aquaculture production varied between 3,700 and 4,900 tonnes, from five countries. Most was produced by Portugal but France and Spain have also been significant producers; however, the contribution from France is now much lower than before; in 1995 it was by far the leading producer with nearly 5,200 tonnes but in 2004 it produced only 475 tonnes. Global production seems to be declining; in 2004 it was only 2,700 tonnes but the United Kingdom had appeared as a minor producer.

In 1985 the price for live Ruditapes decussatus was about € 0.60/kg. In 2005, the price was about € 15/kg. It is consumed fresh and canned.[2]

References

Bibliography

  • Garcia, F. – 1993. Interprétation des stries valvaires pour l'évaluation de la croissance de Ruditapes decussatus L. Oceanologica Acta . 16: 199–203..
  • Poppe, G. T. & Goto, Y. – 1991. European seashells. Vol 1 (Polyplacophora, Caudofoveata, Solenogastra, Gastropoda).Verlag Christa Hemmen .
  • Rodriguez-Moscoso, E & Arnaiz, R – 1998. Gametogenesis and energy storage in a population of the grooved carpet-shell clam, Tapes decussatus (Linne, 1787), in northwest Spain. Aquaculture. . vol. 162, no. 1–2, pp. 125–139 ..
  • Xie, Qiushi & Burnell, GM – 1994. A comparative study of the gametogenic cycles of the clams Tapes philippinarum (A. Adams & Reeve 1850) and Tapes decussatus (Linnaeus) on the south coast of Ireland. Journal of Shellfish Research. . vol. 13, no. 2, pp. 467–472..
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!