Overview

Distribution

Eudocimus ruber is found in northern South America, stretching from Venezuela to Eastern Brazil. It is nomadic, with seasonal shifts and migrations between different coastal locations and interior wetlands.

Biogeographic Regions: neotropical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Coastal Colombia to the Guianas and ne Brazil; Trinidad.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Eudocimus ruber is in the same family as spoonbills. Ibises have slightly webbed feet and a thin, down-curved bill. They fly with the bill forward and neck held straight. All ibises are long-legged and long-necked wading birds, but E. ruber can be characterized by its stunning red plumage and its glossy blue-black wing tips. This bright red color fades to pink in captive zoo birds, unless they are given a specific diet, which consists of high levels of protein and shrimp meat. Although the adults are brightly colored, the young are dull, with a grayish-brown color and white underbellies. Females and males are identical in coloration, but the male's body size and bill length are much larger. Scarlet ibises weigh between 0.772 to 0.935 g, are 55.8 to 76.2 cm long and have wingspans of 52.1 to 56.1 cm. Their metabolic rate can reach 1432 cm^3 oxygen/hour.

Average length: 55.8-76.2 cm.

Average wingspan: 52.1-56.1 cm.

Range basal metabolic rate: 1432 (high) cm3.O2/g/hr.

Sexual Dimorphism: sexes alike; male larger

Other Physical Features: endothermic ; bilateral symmetry

Average mass: 615 g.

  • Microsoft Corporation. 2001. Ibis. Microsoft Encarta Encyclopedia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eudocimus ruber prefers swampy environments such as mud flats and shallow bays. It tends to reproduce and nest on dense brush-covered islands and mangroves near the mouths of rivers.

Habitat Regions: tropical ; terrestrial

Aquatic Biomes: rivers and streams; coastal ; brackish water

Wetlands: marsh ; swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Eudocimus ruber forages for food by either probing in water with its long bill or pecking for prey items on soil surfaces. Their main diet consists of crustaceans and aquatic invertebrates. Crayfish and small crabs compose a bulk of the diet, along with aquatic insects. Frogs, mollusks, small snakes and small fish are also prey for E. ruber.

Animal Foods: amphibians; reptiles; fish; insects; mollusks; aquatic crustaceans

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Eudocimus ruber lives among many other wading birds. While it can live harmoniously with other species, it also defends its individual space very aggressively. Other birds often steal the eggs of E. ruber, thus it must be protective of its territory. Because of its large colonial sizes (which can have anywhere from 20 to 600 nests, and sometimes even up to 2000 nests), E. ruber contributes significantly to the energy flow of organisms in the environment in which it lives. In one wetland, it has been noted to be responsible for 10% of the energy flow through the community.

This species forages for food with many other types of wading birds, such as storks and spoonbills and specifically has been seen living with Brazilian wading ducks. One reason that the species may be mutualistic in sharing feeding areas is that if it allows for a great number of birds to feed communally at its site, then it has a better chance to hide from predators among all the other birds. Also, many wading birds together stir up the shallow water and disturb the prey so that they are easier to find and catch.

Mutualist Species:

  • Many other types of wading birds, such as storks, spoonbills and Brazilian wading ducks.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eudocimus ruber faces the greatest risk of predation by large cats (family Felidae) and birds of prey (order Falconiformes). Their best defense is the fact the E. ruber stays together in large groups. That way, males can use their larger size to defend their young and their female mates. The large grouping is also useful because the birds produce warning calls to warn the others of danger.

Known Predators:

  • large cats (Felidae)
  • birds of prey (Falconiformes)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Eudocimus ruber is prey of:
Felidae
Falconiformes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Eudocimus ruber preys on:
non-insect arthropods
Actinopterygii
Mollusca
Crustacea
Insecta
Amphibia
Reptilia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Eudocimus ruber produces a honking noise to communicate disturbances in the nest and also uses the noise in courtship. The young have a shrill cry, that they use to let parents know that they are in need of food. Touch is important during courtship. The males and females make greeting displays to one another and then wrap necks. The male produces the honking noise during courtship, while the female produces more of a squealing sound.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Young E. ruber have approximately a 50% mortality rate. In general, colonies suffer from high mortality rates due to predation and lack of food. Although information on actual lifespan of E. ruber is limited, data on its North American relative, Eudocimus albus, can be used as an adequate estimate. Eudocimus albus usually lives for about 16 years in the wild and 20 years in captivity; the oldest known captive individual lived 31 years.

Average lifespan

Status: captivity:
33.2 years.

  • Hill, K. 2001. "Smithsonian Marine Station" (On-line). Accessed March 24, 2004 at http://www.sms.si.edu/IRLSpec/Eudoc_albus.htm.
  • Ricklefs, R. 2000. Intrinsic aging-related mortality in birds. Journal of Avian Biology, 31: 103-111.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 33.2 years (captivity) Observations: One specimen lived 33.2 years in captivity (Brouwer et al. 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Eudocimus ruber has a colonial and social breeding system. Nests are generally built close to one another with more than one per tree. This is most likely done to reduce the risks of predation. Males use displays of preening, flights, head rubbing, and a rocking motion to attract mates. A female must be cautious when approaching a male, because he may actually attack her if she does not remain in his display area. Scarlet ibises are polygynous, the males often mate with more than one female.

Mating System: polygynous

Eudocimus ruber begins visiting its colonial nesting sites by mid-September, egg-laying takes place between early November through December. The first egg is laid 5 to 6 days after copulation and there are usually 3 to 5 eggs in each nest. Eggs are not glossy, but are smooth. Incubation lasts between 19 to 23 days. Chicks fledge after 35 days and are independent in 75 days.

Breeding interval: Breeding occurs once yearly

Breeding season: Typically breeding occurs from September through December

Range eggs per season: 3 to 5.

Range time to hatching: 19 to 23 days.

Average fledging age: 35 days.

Average time to independence: 75 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 2.

Young E. ruber are altricial, when they first hatch, they are helpless and cannot even hold up their heads. Both adult birds share in the responsibilities of caring for and tending to the young. Both incubate, provide food and also guard against predators. To feed their chicks adults grab hold of the bill of the young bird, which causes it to raise its head so that the parent can regurgitate into the mouth. The chick's feet develop quite fast; this allows the chicks to fledge as early as 2 weeks. By 40 days old, the young are able to fly well and by 75 days old, they are able to provide for themselves and can leave the colony.

Parental Investment: no parental involvement; altricial ; pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

  • Hancock, J., J. Kushlan, M. Kahl. 1992. Storks, Ibises and Spoonbills of the World. San Diego, CA: Harcourt Brace Jovanovich.
  • Olmos, F., R. Silva. 2001. Breeding Biology and Nest Site Characterisitcs of the Scarlet Ibis in Southeastern Brazil. Waterbirds, 24(1): 58-67.
  • Utah's Hogle Zoo. 2001. "Scarlet Ibis" (On-line). Accessed March 29, 2004 at http://www.xmission.com/~hoglezoo/animals/view.php?id=100.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eudocimus ruber

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATACATAATTTTTGGCGCATGAGCTGGTATAGTTGGAACTGCCCTTAGCTTACTTATCCGCGCAGAACTAGGTCAACCAGGAACACTCCTGGGAGACGACCAAATCTACAATGTAATCGTCACTGCCCATGCCTTCGTAATAATCTTCTTCATAGTCATACCAATCATGATTGGCGGATTTGGCAACTGACTAGTGCCCCTTATAATCGGCGCCCCCGATATAGCCTTTCCCCGCATAAACAATATAAGCTTCTGACTACTACCTCCATCCTTCCTACTCCTTCTAGCCTCCTCCACAGTAGAAGCAGGAGCAGGCACAGGATGAACTGTATACCCACCTCTAGCTGGCAACCTCGCCCATGCTGGAGCCTCAGTAGACCTAGCCATCTTCTCCCTTCACCTAGCAGGGGTATCTTCCATTCTAGGAGCTATTAACTTCATCACAACTGCCATTAACATAAAACCTCCAGCCCTCTCACAATATCAAACACCACTATTCGTTTGATCCGTCCTAATCACTGCCGTTTTACTACTACTCTCTCTACCAGTCCTCGCTGCCGGCATCACCATGCTGCTAACAGATCGAAACCTGAACACCACATTCTTCGACCCTGCAGGAGGAGGAGATCCTGTACTATACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eudocimus ruber

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5