Overview

Distribution

Range

Coastal Colombia to the Guianas and ne Brazil; Trinidad.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Eudocimus ruber is found in northern South America, stretching from Venezuela to Eastern Brazil. It is nomadic, with seasonal shifts and migrations between different coastal locations and interior wetlands.

Biogeographic Regions: neotropical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Eudocimus ruber is in the same family as spoonbills. Ibises have slightly webbed feet and a thin, down-curved bill. They fly with the bill forward and neck held straight. All ibises are long-legged and long-necked wading birds, but E. ruber can be characterized by its stunning red plumage and its glossy blue-black wing tips. This bright red color fades to pink in captive zoo birds, unless they are given a specific diet, which consists of high levels of protein and shrimp meat. Although the adults are brightly colored, the young are dull, with a grayish-brown color and white underbellies. Females and males are identical in coloration, but the male's body size and bill length are much larger. Scarlet ibises weigh between 0.772 to 0.935 g, are 55.8 to 76.2 cm long and have wingspans of 52.1 to 56.1 cm. Their metabolic rate can reach 1432 cm^3 oxygen/hour.

Average length: 55.8-76.2 cm.

Average wingspan: 52.1-56.1 cm.

Range basal metabolic rate: 1432 (high) cm^3 oxygen/hour.

Sexual Dimorphism: sexes alike; male larger

Average mass: 615 g.

  • Microsoft Corporation. 2001. Ibis. Microsoft Encarta Encyclopedia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eudocimus ruber prefers swampy environments such as mud flats and shallow bays. It tends to reproduce and nest on dense brush-covered islands and mangroves near the mouths of rivers.

Habitat Regions: tropical ; terrestrial

Aquatic Biomes: rivers and streams; coastal ; brackish water

Wetlands: marsh ; swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Eudocimus ruber forages for food by either probing in water with its long bill or pecking for prey items on soil surfaces. Their main diet consists of crustaceans and aquatic invertebrates. Crayfish and small crabs compose a bulk of the diet, along with aquatic insects. Frogs, mollusks, small snakes and small fish are also prey for E. ruber.

Animal Foods: amphibians; reptiles; fish; insects; mollusks; aquatic crustaceans

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Eudocimus ruber lives among many other wading birds. While it can live harmoniously with other species, it also defends its individual space very aggressively. Other birds often steal the eggs of E. ruber, thus it must be protective of its territory. Because of its large colonial sizes (which can have anywhere from 20 to 600 nests, and sometimes even up to 2000 nests), E. ruber contributes significantly to the energy flow of organisms in the environment in which it lives. In one wetland, it has been noted to be responsible for 10% of the energy flow through the community.

This species forages for food with many other types of wading birds, such as storks and spoonbills and specifically has been seen living with Brazilian wading ducks. One reason that the species may be mutualistic in sharing feeding areas is that if it allows for a great number of birds to feed communally at its site, then it has a better chance to hide from predators among all the other birds. Also, many wading birds together stir up the shallow water and disturb the prey so that they are easier to find and catch.

Mutualist Species:

  • Many other types of wading birds, such as storks, spoonbills and Brazilian wading ducks.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Eudocimus ruber faces the greatest risk of predation by large cats (family Felidae) and birds of prey (order Falconiformes). Their best defense is the fact the E. ruber stays together in large groups. That way, males can use their larger size to defend their young and their female mates. The large grouping is also useful because the birds produce warning calls to warn the others of danger.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Eudocimus ruber is prey of:
Felidae
Falconiformes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Eudocimus ruber preys on:
non-insect arthropods
Actinopterygii
Mollusca
Crustacea
Insecta
Amphibia
Reptilia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Eudocimus ruber produces a honking noise to communicate disturbances in the nest and also uses the noise in courtship. The young have a shrill cry, that they use to let parents know that they are in need of food. Touch is important during courtship. The males and females make greeting displays to one another and then wrap necks. The male produces the honking noise during courtship, while the female produces more of a squealing sound.

Communication Channels: visual ; tactile ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Young E. ruber have approximately a 50% mortality rate. In general, colonies suffer from high mortality rates due to predation and lack of food. Although information on actual lifespan of E. ruber is limited, data on its North American relative, Eudocimus albus, can be used as an adequate estimate. Eudocimus albus usually lives for about 16 years in the wild and 20 years in captivity; the oldest known captive individual lived 31 years.

Average lifespan

Status: captivity:
33.2 years.

  • Ricklefs, R. 2000. Intrinsic aging-related mortality in birds. Journal of Avian Biology, 31: 103-111.
  • Hill, K. 2001. "Smithsonian Marine Station" (On-line). Accessed March 24, 2004 at http://www.sms.si.edu/IRLSpec/Eudoc_albus.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 33.2 years (captivity) Observations: One specimen lived 33.2 years in captivity (Brouwer et al. 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Eudocimus ruber has a colonial and social breeding system. Nests are generally built close to one another with more than one per tree. This is most likely done to reduce the risks of predation. Males use displays of preening, flights, head rubbing, and a rocking motion to attract mates. A female must be cautious when approaching a male, because he may actually attack her if she does not remain in his display area. Scarlet ibises are polygynous, the males often mate with more than one female.

Mating System: polygynous

Eudocimus ruber begins visiting its colonial nesting sites by mid-September, egg-laying takes place between early November through December. The first egg is laid 5 to 6 days after copulation and there are usually 3 to 5 eggs in each nest. Eggs are not glossy, but are smooth. Incubation lasts between 19 to 23 days. Chicks fledge after 35 days and are independent in 75 days.

Breeding interval: Breeding occurs once yearly

Breeding season: Typically breeding occurs from September through December

Range eggs per season: 3 to 5.

Range time to hatching: 19 to 23 days.

Average fledging age: 35 days.

Average time to independence: 75 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 2.

Young E. ruber are altricial, when they first hatch, they are helpless and cannot even hold up their heads. Both adult birds share in the responsibilities of caring for and tending to the young. Both incubate, provide food and also guard against predators. To feed their chicks adults grab hold of the bill of the young bird, which causes it to raise its head so that the parent can regurgitate into the mouth. The chick's feet develop quite fast; this allows the chicks to fledge as early as 2 weeks. By 40 days old, the young are able to fly well and by 75 days old, they are able to provide for themselves and can leave the colony.

Parental Investment: no parental involvement; altricial ; pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

  • Olmos, F., R. Silva. 2001. Breeding Biology and Nest Site Characterisitcs of the Scarlet Ibis in Southeastern Brazil. Waterbirds, 24(1): 58-67.
  • Hancock, J., J. Kushlan, M. Kahl. 1992. Storks, Ibises and Spoonbills of the World. San Diego, CA: Harcourt Brace Jovanovich.
  • Utah's Hogle Zoo. 2001. "Scarlet Ibis" (On-line). Accessed March 29, 2004 at http://www.xmission.com/~hoglezoo/animals/view.php?id=100.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Eudocimus ruber

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Eudocimus ruber

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTATACATAATTTTTGGCGCATGAGCTGGTATAGTTGGAACTGCCCTTAGCTTACTTATCCGCGCAGAACTAGGTCAACCAGGAACACTCCTGGGAGACGACCAAATCTACAATGTAATCGTCACTGCCCATGCCTTCGTAATAATCTTCTTCATAGTCATACCAATCATGATTGGCGGATTTGGCAACTGACTAGTGCCCCTTATAATCGGCGCCCCCGATATAGCCTTTCCCCGCATAAACAATATAAGCTTCTGACTACTACCTCCATCCTTCCTACTCCTTCTAGCCTCCTCCACAGTAGAAGCAGGAGCAGGCACAGGATGAACTGTATACCCACCTCTAGCTGGCAACCTCGCCCATGCTGGAGCCTCAGTAGACCTAGCCATCTTCTCCCTTCACCTAGCAGGGGTATCTTCCATTCTAGGAGCTATTAACTTCATCACAACTGCCATTAACATAAAACCTCCAGCCCTCTCACAATATCAAACACCACTATTCGTTTGATCCGTCCTAATCACTGCCGTTTTACTACTACTCTCTCTACCAGTCCTCGCTGCCGGCATCACCATGCTGCTAACAGATCGAAACCTGAACACCACATTCTTCGACCCTGCAGGAGGAGGAGATCCTGTACTATACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Many environmental and human threats exist for E. ruber. Overhunting, the harvesting of eggs and the selling of young as pets in open-markets are just three of the things affecting population sizes of E. ruber. Other crucial aspects threatening the species revolve around habitat loss. Nesting ground destruction and loss of foraging and feeding grounds are serious problems, along with heavy pollution in these now limited areas. Disturbance of breeding and foraging areas because of recreational activities, such as boating, is also a complication for colonies of E. ruber. There are laws and regulations that have been issued to protect E. ruber habitats and also gaurd the animal from hunting. However, in many areas, law enforcement is weak. In order to sustain the populations of E. ruber, pollution must be controlled in their breeding and feeding areas and people living in rural areas should be education about the bird. They are protected by the US Migratory Bird Treaty Act and are listed as Appendix II by CITES.

US Migratory Bird Act: protected

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The foraging technique that E. ruber uses sends it into many different environments to find its meals. Unfortunately, their foraging can lead the birds to beaches, gardens, yards, playing fields, golf courses, and even agricultural fields where it can disrupt the residential lives and activities of people. While no major economic downfalls or disturbances have been reported as a result of E. ruber, many consider the large number of birds in these public areas to sometimes be a nuisance.

Negative Impacts: household pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

The importance of the E. ruber dates back to the 16th century when Indian tribes would use the bright feathers for adornment and also eat the meat of the bird. Eudocimus ruber meat and eggs are still used as food by humans and the feathers continue to be used as decorative objects by people both inside and outside of the Indian community.

Positive Impacts: food ; body parts are source of valuable material

  • Frederick, P., L. Morales, A. Spaans, C. Luthin. 1990. The Scarlet Ibis: Status, Conservation, and Recent Research. IWRB Special Publication, No. 11.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Scarlet Ibis

This article is about the bird. For the short story, see The Scarlet Ibis.

The scarlet ibis (Eudocimus ruber) is a species of ibis in the bird family Threskiornithidae. It inhabits tropical South America and islands of the Caribbean. In form it resembles most of the other twenty-seven extant species of ibis, but its remarkably brilliant scarlet coloration makes it unmistakable.

This medium-sized wader is a hardy, numerous, and prolific bird, and it has protected status around the world. Its IUCN status is Least Concern. The legitimacy of Eudocimus ruber as a biological classification, however, is in dispute. Traditional Linnaean taxonomy classifies it as a unique species, but an increasing number of scientists have moved to reclassify it as a subspecies of a more general American ibis species, along with its close relative Eudocimus albus.

Taxonomy[edit]

The species was first classified by Carl Linnaeus in 1758. Initially given the binomial nomenclature of Scolopax rubra[2] (the name incorporates the Latin adjective ruber, "red"), the species was later designated Guara rubra and ultimately Eudocimus ruber.[3]

Biologically the scarlet ibis is very closely related to the American white ibis (Eudocimus albus) and is sometimes considered conspecific with it,[2][4] leaving modern science divided over their taxonomy. The two birds each have exactly the same bones, claws, beaks, feather arrangements and other features – their one marked difference lies in their pigmentation.[5] Traditional taxonomy has regarded the two as separate and distinct.[5]

Early ornithological field research revealed no natural crossbreeding among the red and white, lending support to the two-species viewpoint.[5] More recent observation, however, has documented significant crossbreeding and hybridization in the wild. Researchers Cristina Ramo and Benjamin Busto found evidence of interbreeding in a population where the ranges of the scarlet and white ibises overlap along the coast and in the Llanos in Colombia and Venezuela. They observed individuals of the two species mating and pairing, as well as hybrid ibises with pale orange plumage, or white plumage with occasional orange feathers, and have proposed that these birds be classified as a single species.[2] Hybridization has been known to occur frequently in captivity. However, the two color forms persist in the wild despite overlapping ranges and hybrid offspring having a distinctive color type, so according to the cohesion species concept they would be functionally different species.[6]

Some biologists now wish to pair them with Eudocimus albus as two subspecies of the same American ibis.[2] Others simply define both of them as one and the same species, with ruber being a color variation of albus.[7]

Description[edit]

An older juvenile with a touch of red

Adult plumage is virtually all scarlet. The feathers may show various tints and shades, but only the tips of their wings deviate from their namesake color. A small but reliable marking, these wingtips are a rich inky black (or occasionally dark blue) and are found only on the longest primaries[8] – otherwise the birds' coloration is "a vivid orange-red, almost luminous in quality."[9] Scarlet ibises have red bills and feet however the bill is sometimes blackish, especially toward the end.[10] They have a long, narrow, decurved bill. Their legs and neck are long and extended in flight.[11]

A juvenile scarlet ibis is a mix of grey, brown, and white. As it grows, a heavy diet of red crustaceans produces the scarlet coloration.[12] The color change begins with the juvenile's second moult, around the time it begins to fly: the change starts on the back and spreads gradually across the body while increasing in intensity over a period of about two years.[8] The scarlet ibis is the only shorebird with red coloration in the world.[12]

Adults are 55–63 centimetres (22–25 in) long,[13] and the males, slightly larger than females, typically weigh about 1.4 kilograms (3.1 lb).[8] Their bills are also on average around 22% longer than those of females.[14] The life span of the scarlet ibis is approximately sixteen years in the wild and twenty years in captivity.[15] An adult scarlet ibis has a wingspan of around 54 centimetres (21 in).[8] Though it spends most of its time on foot or wading through water, the bird is a very strong flyer:[12] they are highly migratory and easily capable of long-distance flight. They move as flocks in a classic V formation.[8]

Distribution and habitat[edit]

Head of scarlet ibis

The range of the scarlet ibis is very large, and colonies are found throughout vast areas of South America and the Caribbean islands. Native flocks exist in Argentina; Brazil; Colombia; French Guiana; Guyana; Suriname; and Venezuela, as well as the islands of the Netherlands Antilles, and Trinidad and Tobago.[1] Flocks gather in wetlands and other marshy habitats, including mud flats, shoreline and rainforest.[8] There is an outlying colony in the Santos-Cubatão mangroves of Baixada Santista district in southeastern Brazil, which is considered critically endangered.[16]

The highest concentrations are found in the Llanos region between western Venezuela and eastern Colombia. The fertile and remote tropical grassland plain of the Llanos provides a safe haven far from human encroachment.[9] Together with its relative the bare-faced ibis, the scarlet ibis is remarkably prolific and conspicuous in the region.[17]

Scarlet ibis vagrants have been identified in Belize, Ecuador, and Panama; Aruba, Cuba, Dominica, Grenada, and Jamaica; sightings have even been made in the United States.[1] The species may well have been a natural vagrant to the Gulf Coast in the 19th century or earlier – in The Birds of America, John James Audubon made brief remarks regarding three rubra specimens he encountered in Louisiana.[18] However, virtually all modern occurrences of the species in North America have been introduced or escaped birds. In one notable example from 1962, scarlet ibis eggs were placed in white ibis nests in Florida's Hialeah Park, and the resulting population hybridised easily, producing "pink ibises" that are still occasionally seen.[13][19]

Behavior[edit]

Breeding[edit]

Mating pairs build nests in a simple style, typically "loose platforms of sticks"[12] of a quality sometimes described as "artless".[20] They roost in leaf canopies, mostly preferring the convenient shelter of young waterside mangrove trees.[21] Scarlet ibises like wet, muddy areas such as swamps, but for safety they build their nests in trees well above the water. If they can, they nest on islands, where their eggs and chicks are less likely to be in danger from predators.[22]

To attract a female, the male will perform a variety of mating rituals such as "preening, shaking, bill popping, head rubbing, and high flights."[8] As with most birds, mating does not involve any coupling or insertion: instead, a transfer of seminal fluids occurs during external contact between the cloacal openings.[23] After a gestation period of five to six days,[8] the female lays a clutch of three to five smooth, matte eggs which typically incubate for 19–23 days.[15][24] After a successful courtship, pairs remain faithful and cohabitant, sharing parental responsibilities for the young.[8]

In southeastern Brazil, the ibises gather in colonies in mid-September and build nests at the beginning of November. Egg laying within the colony was synchronous, with female birds laying eggs in three waves in early November, late December and late January.[16]

Feeding[edit]

"While showering dignity and color on the scarlet ibis, nature seems to have been reluctant in the bestowal of weapons. The bird's beak was blunt, its toenails were unsharpened, and its eyes had a gentle, soft Bambi quality."
Dr. Paul A. Zahl, Coro-Coro [25]

Their distinctive long, thin bills are used to probe for food in soft mud or under plants.[9] Popularly imagined to be eating only shrimp, a recent study in Llanos has found that much of their diet consists of insects, of which the majority were scarabs and ground beetles . One species in particular, a scarab beetle Dyscinetus dubius, formed a large part of the diet. In contrast, the diet of the co-occurring American white ibis there differed, the latter consuming more bugs, fish and crustaceans.[26]

They do, however, eat much shrimp and other similar fare like small crabs, mollusks and other crustaceans.[12] The large quantity of shrimp and other red shellfish produces a surfeit of astaxanthin, a carotenoid which is the key component of the birds' red pigmentation.[12][27] When kept in zoos, the birds' diet often contains beetroot and carrot supplement to maintain color vibrancy in their plumage.[12]

The Llanos are notable in that these wetland plains support seven species of ibis in the one region. Here, scarlet ibis are the most aggressive, and attack other species to steal their food. They have also been observed trailing white-faced whistling ducks (Dendrocygna viduata) and domestic livestock, and catching insects disturbed by them.[28]

Social behavior[edit]

The scarlet ibis is a sociable and gregarious bird, and very communally-minded regarding the search for food and the protection of the young. They live in flocks of thirty or more. Members stay close, and mating pairs arrange their nests in close proximity to other pairs in the same tree.[8]

For protection, flocks often congregate in large colonies of several thousand individuals.[8] They also regularly share time among other avian creatures, gaining additional safety through numbers: storks, spoonbills, egrets, herons and ducks are all common companions during feedings and flights.[8]

Status[edit]

The species has protected status throughout the world,[12] and the International Union for Conservation of Nature has classified the scarlet ibis as a species of Least Concern on the IUCN Red List.[1] Though several local populations appear to be in decline, global totals remain relatively large and the current rate of losses is not considered a threat to the species' survival.[1] Nonetheless, recent losses by established populations in French Guiana and the Florida Everglades have become a concern for conservationists, and in Brazil the bird has been included on a national list of endangered species.[29]

Relationship with humans[edit]

The scarlet ibis is the national bird of Trinidad.[30] It is featured on the present-day coat of arms of Trinidad and Tobago,[31] along with Tobago's national bird, the cocrico.[30] The island nation maintains the wildlife sanctuary of Caroni Swamp, a 199 hectares (490 acres) wetland reserve first designated in 1953 specifically to provide a habitat for the scarlet ibis.[32]

Using the bird as a literary symbol, American author James Hurst composed an enduringly popular short story entitled "The Scarlet Ibis", first published in 1960.[9] A more recent short story, "Scarlet Ibis" by Margaret Atwood, is included in Bluebeard's Egg (1983).[33] The name also belongs to a book of verse by American poet Susan Hahn.[34]

References[edit]

  1. ^ a b c d e BirdLife International (2012). "Eudocimus ruber". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d Ramo, Cristina; Busto, Benjamin (1987). "Hybridization Between the Scarlet Ibis (Eudocimus ruber) and the White Ibis (Eudocimus albus) in Venezuela". Colonial Waterbirds 10 (1): 111–14. doi:10.2307/1521240.  edit
  3. ^ Denis Lepage (2003). "Scarlet Ibis (Eudocimus ruber) (Linnaeus, 1758)". Avibase.bsc-eoc.org. BirdLife International. Retrieved 12 December 2011. 
  4. ^ Kushlan, James A.; Bildstein, Keith L. (February 10, 2009). "White Ibis". Birds of North America Online. Cornell University. Retrieved 12 December 2011. 
  5. ^ a b c Zahl, Paul A. (1954). Coro-Coro: The World of the Scarlet Ibis. Indianapolis/New York: Bobbs-Merrill Co. pp. 192–193. OCLC 799120. 
  6. ^ K. Hill (2001). "Species Name: Eudocimus albus". Sms.si.edu. Smithsonian Institution: Marine Station at Fort Pierce. Retrieved 12 December 2011. 
  7. ^ Nellis, David W. (March 2001). Common Coastal Birds of Florida & the Caribbean. Pineapple Press Inc. p. 151. ISBN 978-1-56164-191-8. Retrieved 12 December 2011. 
  8. ^ a b c d e f g h i j k l Moolchan, Esther (2011). "The Online Guide to the Animals of Trinidad and Tobago: Eudocimus ruber (Scarlet Ibis)" (PDF). Sta.uwi.edu. University of the West Indies. Retrieved 12 December 2011. 
  9. ^ a b c d Moss, Steven; Birdlife International (2008). Remarkable Birds: 100 of the World's Most Notable Birds. HarperCollins. p. 42. ISBN 978-0-06-162664-7. Retrieved 12 December 2011. 
  10. ^ Ridgway, Robert. “Upon the Close Relationship Between the White and Scarlet Ibises(Eudocimus Albus and E. Rubber).” The Auk 1. 3 (1884): 239-240.
  11. ^ McWilliams, Gerald M, and Daniel W. Brauning. The Birds of Pennsylvania. Ithaca, N.Y: Cornell University Press, 2000. Print.
  12. ^ a b c d e f g h Binghamton Zoo at Ross Park (2011). "Scarlet Ibis (Eudocimus ruber)". Rossparkzoo.com. Binghamton Zoo. Retrieved 12 December 2011. 
  13. ^ a b Peterson, Roger Tory; Peterson, Virginia Marie (2002). A Field Guide to the Birds of Eastern and Central North America. Houghton Mifflin Harcourt. p. 47. ISBN 978-0-395-74047-7. Retrieved 12 December 2011. 
  14. ^ Babbitt, Gregory A.; Frederick, Peter C. (2007). "Selection for sexual bill dimorphism in ibises: An evaluation of hypotheses". Waterbirds 30 (2): 199–206. doi:10.1675/1524-4695(2007)30[199:SFSBDI]2.0.CO;2. 
  15. ^ a b Phelps, Katherine (2008). "Eudocimus ruber: Scarlet Ibis". Animaldiversity.ummz.umich.edu. University of Michigan Museum of Zoology. Retrieved 12 December 2011. 
  16. ^ a b Olmos, Fábio; Silva E Silva, Robson, F. b.; Silva, R. S. E.; Olmos, Fabio (2001). "Breeding Biology and Nest Site Characteristics of the Scarlet Ibis in Southeastern Brazil". Waterbirds: the International Journal of Waterbird Biology 24 (1): 58–67. doi:10.2307/1522244. JSTOR 1522244. 
  17. ^ Hilty, Steven L.; de Schauensee, Rodolphe Meyer (2003). Birds of Venezuela. Princeton University Press. p. 218. ISBN 978-0-691-09250-8. Retrieved 12 December 2011. 
  18. ^ Audubon, John James (1843). The Birds of America VI. J.J. Audubon. p. 53. Retrieved 12 December 2011. 
  19. ^ Zahl, Paul A. (1967). "New Scarlet Ibis in Florida skies". National Geographic 32: 847–82. 
  20. ^ Bent, Arthur Cleveland (1926). "Life Histories of North American Marsh Birds". United States National Museum Bulletin (Smithsonian Institution) (35): 36. Retrieved 12 December 2011. "The scarlet ibis builds its artless nest of brush in inaccessible places on low trees." 
  21. ^ Jan Hein Ribot (2010). "Scarlet Ibis". Nhl.nl. NHL Hogeschool. Retrieved 12 December 2011. 
  22. ^ Herons and Relatives. Animals: A Visual Encyclopedia. London: Dorling Kindersley Publishing, Inc., 2008. Credo Reference. Web. 17 September 2012.
  23. ^ Zahl (1954), p. 194.
  24. ^ Zahl (1954), p. 195.
  25. ^ Zahl, p. 188.
  26. ^ Aguilera, Eduardo; Ramo, Cristina; Busto, Benjamin (1993). "Food Habits of the Scarlet and White Ibis in the Orinoco Plains". The Condor 95 (3): 739–41. doi:10.2307/1369623. 
  27. ^ Krinsky, Norman I.; Mathews-Roth, Micheline M.; Taylor, Richard F. (1989). Carotenoids: chemistry and biology. New York: Plenum Press. ISBN 978-0-306-43607-9. Retrieved 12 December 2011. 
  28. ^ Frederick, Peter C.; Bildstein, Keith L. "Foraging Ecology of Seven Species of Neotropical Ibises (Threskiornithidae) during the Dry Season in the Llanos of Venezuela". The Wilson Bulletin 104 (1): 1–21. 
  29. ^ James Hancock; James A. Kushlan (2010). Storks, Ibises and Spoonbills of the World. A&C Black. p. 359. ISBN 978-1-4081-3500-6. Retrieved 12 December 2011. 
  30. ^ a b Government of the Republic of Trinidad and Tobago (2008). "National Birds". Trinidad and Tobago Government Online. Retrieved 12 December 2011. 
  31. ^ Government of the Republic of Trinidad and Tobago (2008). "National Emblems". Trinidad and Tobago Government Online. Retrieved 12 December 2011. 
  32. ^ Salm, Rodney V.; Clark, John R.; Siirila; International Union for Conservation of Nature and Natural Resources (2000). Marine and Coastal Protected Areas: A guide for planners and managers. IUCN. pp. 334–337. ISBN 978-2-8317-0540-8. Retrieved 12 December 2011. 
  33. ^ Lutwack, Leonard (February 1994). Birds in Literature. University Press of Florida. p. 235. ISBN 978-0-8130-1254-4. Retrieved 17 December 2011. 
  34. ^ Hahn, Susan (2007). The Scarlet Ibis: Poems. Evanston, IL: Northwestern University Press. ISBN 978-0-8101-5183-3. Retrieved 12 December 2011. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!