Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 17 - 70.3165

Graphical representation

Depth range (m): 17 - 70.3165
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Halgerda willeyi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGACTATTAGGAACAGGACTTAGACTGCTAATTCGATTTGAGTTAGGAACAGCAGGTGCCTTCCTTGGTGAT---GATCACTTTTATAACGTAATTGTTACTGCGCATGCTTTTGTAATAATTTTTTTTATAGTAATACCACTAATAATTGGAGGTTTTGGGAATTGAATAGTACCCTTACTAATTGGAGCACCAGATATAAGATTTCCTCGTATAAATAATATGAGTTTTTGGTTACTTCCTCCATCTTTTATTCTTCTATTATGTTCAACTCTAATAGAAGGAGGGGCTGGTACAGGATGAACTGTCTACCCACCACTATCTGGACCAGTTGCTCATGGAGGTACTTCCGTAGACTTGGCCATTTTTTCATTACATTTAGCAGGGGCTTCCTCACTCCTTGGTGCTATTAATTTTATTACTACAATTTTCAATATACGATCCTCGGCTATATCTATAGAACGAGTAAGACTATTTGTATGATCAGTATTAGTTACAGCTTTCTTACTTCTACTTTCTCTTCCAGTTCTTGCAGGAGCAATTACTATGTTATTAACTGACCGAAACTTTAACACTAGGTTTTTTGATCCAGCAGGGGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Halgerda willeyi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at Florida Museum of Natural History
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Halgerda willeyi

Halgerda willeyi is a species of sea slug. It is a dorid nudibranch, and shell-less marine gastropod mollusk in the family Discodorididae. [1]

Contents

Description

The body of the Halgerda willeyi is rigid, with soft curves and various colours. This species is a fairly large halgerdid,[2] and can reach 5 cm.[3]

Distribution

Halgerda willeyi can be found throughout the western Indo-Pacific, including Taiwan, Vietnam, Myanmar, Egypt, Indonesia, Malaysia and Australia.[4] and in the Red Sea.

References

Further reading

  • Fahey, S. J. & Gosliner, T. M. 2001. The Phylogeny of Halgerda (Opisthobranchia, Nudibranchia) with the description of a new species from Okinawa. Zoologica Scripta, 30(3): 199-213. Abstract
  • Marshall, J.G. & Willan, R.C. 1999. Nudibranchs of Heron Island, Great Barrier Reef - A Survey of the Opisthobranchia (Sea Slugs) of Heron and Wistari Reefs. Backhuys Publishers Leiden.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!