Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 17 - 70.3165

Graphical representation

Depth range (m): 17 - 70.3165
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Halgerda willeyi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GGACTATTAGGAACAGGACTTAGACTGCTAATTCGATTTGAGTTAGGAACAGCAGGTGCCTTCCTTGGTGAT---GATCACTTTTATAACGTAATTGTTACTGCGCATGCTTTTGTAATAATTTTTTTTATAGTAATACCACTAATAATTGGAGGTTTTGGGAATTGAATAGTACCCTTACTAATTGGAGCACCAGATATAAGATTTCCTCGTATAAATAATATGAGTTTTTGGTTACTTCCTCCATCTTTTATTCTTCTATTATGTTCAACTCTAATAGAAGGAGGGGCTGGTACAGGATGAACTGTCTACCCACCACTATCTGGACCAGTTGCTCATGGAGGTACTTCCGTAGACTTGGCCATTTTTTCATTACATTTAGCAGGGGCTTCCTCACTCCTTGGTGCTATTAATTTTATTACTACAATTTTCAATATACGATCCTCGGCTATATCTATAGAACGAGTAAGACTATTTGTATGATCAGTATTAGTTACAGCTTTCTTACTTCTACTTTCTCTTCCAGTTCTTGCAGGAGCAATTACTATGTTATTAACTGACCGAAACTTTAACACTAGGTTTTTTGATCCAGCAGGGGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Halgerda willeyi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at Florida Museum of Natural History
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Halgerda willeyi

Halgerda willeyi is a species of sea slug. It is a dorid nudibranch, a shell-less marine gastropod mollusk in the family Discodorididae.[2]

Distribution[edit]

This species was described from a single specimen collected at Lifou, Loyalty Islands, by Dr A. Willey.[1] Halgerda willeyi has been reported throughout the western Indo-Pacific, including Taiwan, Vietnam, Myanmar, Egypt, Indonesia, Malaysia and Australia and in the Red Sea.[3][4][5]

Description[edit]

The body of the Halgerda willeyi is rigid, with a series of acute interconnecting ridges. The ridges are topped with a yellow or orange line. The grooves between the ridges have chocolate brown lines and these lines extend right to the edge of the mantle as numerous radiating lines. This species is a fairly large halgerdid,[6] and can reach 50 mm.[7]

References[edit]

  1. ^ a b Eliot, C.N.E. (1904) On some nudibranchs from East Africa and Zanzibar. Part III. Dorididae Cryptobranchiatae, I. Proceedings of the Zoological Society of London, 1903(2): 354-385, Pls. 32-34. (published April 1, 1904)
  2. ^ WoRMS (2010). Halgerda willeyi Eliot, 1904. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=221077 on 2011-08-24
  3. ^ Marshall, J.G. & Willan, R.C. 1999. Nudibranchs of Heron Island, Great Barrier Reef - A Survey of the Opisthobranchia (Sea Slugs) of Heron and Wistari Reefs. Backhuys Publishers Leiden.
  4. ^ Halgerda willeyi at Nudipixel
  5. ^ Rudman, W.B., 1998 (June 17) Halgerda willeyi Eliot, 1904. [In] Sea Slug Forum. Australian Museum, Sydney.
  6. ^ Okinawa sea slugs
  7. ^ Halgerda willeyi on the Slug Site
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!