Overview
Distribution
Mascarene Basin, Mauritius, Red Sea, Tanzania
-
Vine, P. (1986). Red Sea Invertebrates. Immel Publishing, London. 224 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5987
-
Drivas, J. & M. Jay (1988). Coquillages de La Réunion et de l'île Maurice
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5910
-
Geiger, D.L. (1999). Distribution and biogeography of the recent Haliotidae (Gastropoda : Vetigastropoda) World-wide, Bollettino Malacologico, Roma, 35(5-12) - Società Italiana di Malacologica.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6355
Trusted
Ecology
Habitat
Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 2 - 12
Temperature range (°C): 26.692 - 28.170
Nitrate (umol/L): 0.394 - 0.923
Salinity (PPS): 34.120 - 35.037
Oxygen (ml/l): 4.336 - 4.685
Phosphate (umol/l): 0.122 - 0.238
Silicate (umol/l): 0.983 - 2.754
Graphical representation
Depth range (m): 2 - 12
Temperature range (°C): 26.692 - 28.170
Nitrate (umol/L): 0.394 - 0.923
Salinity (PPS): 34.120 - 35.037
Oxygen (ml/l): 4.336 - 4.685
Phosphate (umol/l): 0.122 - 0.238
Silicate (umol/l): 0.983 - 2.754
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 2 - 12
Temperature range (°C): 26.692 - 28.170
Nitrate (umol/L): 0.394 - 0.923
Salinity (PPS): 34.120 - 35.037
Oxygen (ml/l): 4.336 - 4.685
Phosphate (umol/l): 0.122 - 0.238
Silicate (umol/l): 0.983 - 2.754
Graphical representation
Depth range (m): 2 - 12
Temperature range (°C): 26.692 - 28.170
Nitrate (umol/L): 0.394 - 0.923
Salinity (PPS): 34.120 - 35.037
Oxygen (ml/l): 4.336 - 4.685
Phosphate (umol/l): 0.122 - 0.238
Silicate (umol/l): 0.983 - 2.754
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Haliotis varia
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
GCTCTAAGCCTTCTAATCCGAGCAGAACTCGGACAGCCAGGAGCGCTTCTTGGAGAC---GACCAACTTTACAACGTAATTGTTACAGCCCACGCTTTCGTCATAATCTTCTTCTTAGTCATGCCATTAATAATTGGTGGATTCGGGAACTGACTAGTGCCCCTAATACTAGGGGCACCCGACATAGCCTTCCCCCGTCTCAACAACATGAGATTCTGACTTCTTCCGCCATCCCTCACTGTGCTACTAACATCAGGTGCTGTAGAAAGGGGCGCCGGAACAGGATGGACAGTATATCCACCACTATCTAGCAACCTGGCCCACGCTGGTGCATCGGTAGACCTGGCCATTTTCTCCCTTCACTTAGCAGGAATCTCCTCAATTCTAGGGGCAGTCAATTTCATTACAACAGTCATAAATATGCGGGTCAAAGCCCAACCTCTAGAACGAATACCTTTATTTGTCTGATCGGTTAAAATTACTGCCGTCCTCCTTCTCCTCTCACTTCCAGTTCTCGCCGGTGCTATTACTATACTTCTTACCGACCGTAATTTC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Haliotis varia
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Trusted
Genomic DNA is available from 7 specimens with morphological vouchers housed at Florida Museum of Natural History and Moscow State Univ
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!

