Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Amundsen/Bellingshausen Sea, Antarctic 200NM zone beyond the coastline , Antarctic Ocean, Antarctic Peninsula, Balleny Islands, East Antarctic Dronning Maud Land, East Antarctic Enderby Land, East Antarctic Wilkes Land, Heard and Macdonald Islands, Malvinas/Falklands, Ross Sea, South Georgia, South Georgian and the South Sandwich Islands Exclusive Economic Zone, South Orkney Islands, South Sandwich Islands, South Shetland Islands, Terra Nova Bay, Victoria Land, Weddell Sea
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 88 specimens in 1 taxon.
Water temperature and chemistry ranges based on 48 samples.

Environmental ranges
  Depth range (m): 0 - 805
  Temperature range (°C): -1.821 - 7.032
  Nitrate (umol/L): 15.133 - 34.029
  Salinity (PPS): 33.651 - 34.788
  Oxygen (ml/l): 4.175 - 7.913
  Phosphate (umol/l): 1.371 - 2.324
  Silicate (umol/l): 7.612 - 102.460

Graphical representation

Depth range (m): 0 - 805

Temperature range (°C): -1.821 - 7.032

Nitrate (umol/L): 15.133 - 34.029

Salinity (PPS): 33.651 - 34.788

Oxygen (ml/l): 4.175 - 7.913

Phosphate (umol/l): 1.371 - 2.324

Silicate (umol/l): 7.612 - 102.460
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sterechinus neumayeri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACACTATATTTGATTTTTGGAGCTTGAGCGGGCATGGTAGGAACTGCCATGAGCGTAATTATTCGAGCTGAGCTGGCGCAACCAGGCTCTCTACTGAAAGAT---GACCAGATCTACAAAGTGATTGTTACTGCGCACGCACTAGTTATGATTTTTTTTATGGTGATGCCAATAATGATAGGAGGATTTGGAAACTGACTTATCCCACTAATGATCGGAGCACCCGACATGGCTTTCCCCCGAATGAAAAACATGAGATTTTGATTGATTCCCCCCTCTTTTATCTTACTTTTGGCCTCAGCTGGAGTCGAAAGAGGAGCAGGAACAGGATGAACTATTTATCCCCCCCTATCTAGTAAAATAGCACACGCCGGAGGGTCAGTTGACCTAGCGATTTTTTCGCTACATCTTGTAGGTGCTTCCTCTATATTAGCCTCAATAAATTTTATTACTACAATTATTAACATGCGAACACCAGGTATGTCTTTTGACCGACTGCCCTTATTTGTTTGGTCTGTTTTTGTAACTGCCTTTTTGTTGCTTCTTTCCTTACCAGTCTTAGCTGGAGCAATAACCATGCTCTTAACAGACCGAAACATTAATACCACATTTTTTGACCCAGCTGGAGGAGGAGACCCCATCTTATTTCAACACTTATTTTGATTTTTCGGACATCCAGAAGTCTACATCCTTATCTTACCCGGCTTTGGAATGATTTCGCACGTGATTGCCCACTACTCAGGAAAGCGAGAACCGTTTGGATATCTAGGAATGGTCTACGCTATGATTGCAATTGGAGTTCTGGGATTTCTAGTATGGGCACACCATATGTTTACGGTTGGAATGGATGTTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sterechinus neumayeri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sterechinus neumayeri

Sterechinus neumayeri, the Antarctic sea urchin, is a species of sea urchin in the family Echinidae. It is found living on the seabed in the waters around Antarctica. It has been used as a model organism in the fields of reproductive biology, embryology, ecology, physiology and toxicology.[2]

Contents

Molecular phylogeny

The mitochondrial DNA of the Antarctic sea urchin and several other urchins found in the circumpolar region was examined in order to assess their phylogenetic relationships. It was found that Sterechinus neumayeri was most closely related to Paracentrotus lividus and Loxechinus albus, both of which are found in the southernmost part of South America. The divergence of the 3 species began 35 to 25 million years ago, which coincides with the period at which Antarctica became separated from South America.[2]

Description

Underwater photo from McMurdo Sound with an ice wall behind and several Antarctic sea urchins, many Antarctic scallops and a brittle star, Ophionotus victoriae.

The Antarctic sea urchin ranges in colour from bright red to dull purple and can grow to 5 centimetres (2.0 in) in diameter. The test is globular with vertical rows of long, strong, white-tipped spines between which there is a dense covering of smaller spines and vertical rows of tube feet. The spines and tube feet enable the animal to move across the ground. There are often fragments of red algae adhering to the spines.[3][4]

Distribution

The Antarctic sea urchin is found in circumpolar waters including the Southern Ocean, the Balleny Islands, South Georgia and the South Sandwich Islands, Terra Nova Bay and Victoria Land.[1] Most of the specimens found have been in water down to a depth of about 250 metres (820 ft).

Biology

The Antarctic sea urchin largely feeds on diatoms and other algae. It also consumes foraminiferans, amphipods, bryozoans, hydrozoans, polychaete worms and sponges and also seal faeces when available.[5][6]

The Antarctic sea urchin is often found living in association with the Antarctic scallop, Adamussium colbecki and the seastar, Odontaster validus.[7]

Research

Metabolism

Metabolic processes tend to slow down as the temperature decreases and the Antarctic sea urchin lives in an extremely cold environment. A research study has found that the larvae use energy 25 times more efficiently than other organisms do.[4] Mature urchins were collected from under the sea ice and moved to a research laboratory at McMurdo Sound where they were induced to spawn. Over 10 million embryos were used to test the protein turnover rates and the associated changes in metabolic rates in the larvae as they developed and this super-efficiency was found. Despite this, it took the larvae a year to develop into juveniles. The mechanism for this energy efficiency was unclear but it was surmised that if it could be transferred through genetic manipulation to other organisms such as clams, oysters or fish, it could transform aquaculture.[4]

Global warming

A research study examined whether the reproductive capacity of the Antarctic sea urchin and the Antarctic proboscis worm (Parborlasia corrugatus) would cope with the increased ocean acidification that would be likely to accompany global warming. It was found that a lowering of the pH from the normal level of 8.0 to 7.0 had little effect on reproduction in the worm, apart from a slight increase in the number of abnormal later-stage embryos. In the urchin, fertilisation rates were reduced at a pH below 7.3, but only at low sperm concentrations. There was a considerable increase in abnormal embryos at later stages of development under lowered pH conditions. In the case of these two cold water invertebrates, these results were not more significant than those of other example organisms from more temperate regions of the world.[8]

References

  1. ^ a b Kroh, Andreas (2010). "Sterechinus neumayeri (Meissner, 1900)". In A. Kroh & R. Mooi. World Echinoidea Database. World Register of Marine Species. Retrieved 2012-01-09. 
  2. ^ a b Lee, Youne-Ho et al. (2004). "Molecular phylogeny and divergence time of the Antarctic sea urchin (Sterechinus neumayeri) in relation to the South American sea urchins". Antarctic Science 16 (1): 29–36. doi:10.1017/S0954102004001786. 
  3. ^ Stirechinus Desor, 1856 The Natural History Museum. Retrieved 2012-01-09.
  4. ^ a b c Antarctic Sea Urchin Shows Amazing Energy-Efficiency in Nature's Deep Freeze Retrieved 2012-01-10.
  5. ^ Antarctic sea urchin Underwater photography. Retrieved 2012-01-09.
  6. ^ Pearse, J. S. & A. C. Giese (1966). "Food, reproduction and organic constitution of the common Antarctic echinoid Sterechinus neumayeri (Meissner)". Biological Bulletin 130: 387–401. 
  7. ^ Chiantore, Mariachiara & Riccardo Cattaneo-vietti (2002). "Reproduction and condition of the scallop Adamussium colbecki ( Smith 1902 ), the sea-urchin Sterechinus neumayeri ( Meissner 1900 ) and the sea-star Odontaster validus ( Koehler 1911 ) at Terra Nova Bay ( Ross Sea )". Marine Biology 25: 251–255. doi:10.1007/s00300-001-0331-1. 
  8. ^ Ericson, Jessica A.; Lamare, Miles D.; Morley, Simon A.; Barker, Mike F (2010). "The response of two ecologically important Antarctic invertebrates (Sterechinus neumayeri and Parborlasia corrugatus) to reduced seawater pH: Effects on fertilisation and embryonic development". Marine Biology 157 (12): 2689–2702. doi:10.1007/s00227-010-1529-y. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!