Overview

Comprehensive Description

Description

 Ramphogordius sanguineus is a moderately-sized free-living nemertean worm that can reach up to 20 cm in length and 3 mm in width. Like all ribbon worms, it is an unsegmented, bilaterally symmetrical ciliated worm with a separate mouth and anus. Ramphogordius sanguineus has longitudinal grooves on opposite sides of its head with four to six eyes on each side and a distinct mouth. When irritated it contracts into tight coils. It has varied but uniform colouring.Ramphogordius sanguineus can be differentiated from similar species such as Lineus rubens by having its eyes arranged more regularly and further back.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

 Ramphogordius sanguineus is an intertidal species. It is usually found under rocks or embedded in black mud.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ramphogordius sanguineus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACTCTTTATTTTCTTTTTGGCATTTGATCTGGGTTAGTTGGGACAGGACTTAGTATGTTGATCCGGGCTGAGTTGGGTCAGCCGGGGGCTTTGTTGGGAGAT---GATCATCTTTATAATGTGATTGTTACAGCTCATGCTTTTGTRATAATCTTTTTCTTGGTTATGCCCGTGATGATTGGTGGTTTTGGGAATTGACTTGTTCCTTTGATGTTGGGGGCTCCGGATATGGCTTTTCCTCGTATGAACAATATAAGTTTCTGGTTGTTGCCTCCTGCTTTGACTTTACTTTTAGGTTCAGCTGCAGTTGAGGGGGGAGCGGGGACGGGTTGGACGGTTTATCCTCCGCTTGCAGGTAATGTGGCCCATGCTGGGGGGTCTGTAGATTTGGCTATTTTTTCTCTTCACTTGGCGGGTGTGTCTTCTATTTTGGGGGCTATTAATTTTATTACTACTGTTGTTAATATGCGCTGGCGAGGTTTGCAGTTTGAGCGGCTTCCTTTGTTTGTTTGGTCTGTGAAAATTACTGCGATTTTATTGTTGTTATCCTTACCTGTCTTGGCGGGGGCCATTACTATGTTGTTAACCGATCGTAATTTCAATACCTCTTTTTTTGATCCAGCAGGGGGGGGAGATCCAATTCTTTATCAGCATCTTTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ramphogordius sanguineus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!