Molecular Biology and Genetics

Molecular Biology

Barcode data: Cleorodes lichenaria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CATAAAGATATTGGAACATTATATTTTATTTTTGGTATTTGGGCAGGAATAGTAGGAACTTCTCTAAGATTATTAATTCGAGCTGAATTAGGAAACCCCGGATCTTTAATTGGGGAT---GATCAAATCTATAATACTATTGTAACTGCTCACGCTTTCATTATAATTTTTTTTATAGTAATACCCATTATAATTGGGGGGTTTGGAAATTGACTAGTGCCTTTAATACTTGGGGCCCCTGATATAGCATTCCCACGAATAAATAATATAAGATTTTGATTATTACCTCCATCCATTACATTATTAATTTCAAGAAGAATTGTAGAAAACGGAGCCGGCACTGGTTGAACAGTTTATCCCCCTTTATCTTCTAATATTGCACATGGTGGAAGTTCGGTAGATCTTGCTATTTTTTCATTACATTTAGCCGGTATTTCATCTATTTTGGGTGCTATTAACTTTATTACCACTATTATTAATATACGATTAAATAATTTATCATTTGATCAAATACCATTATTTGTTTGATCTGTTGGAATTACAGCATTTTTATTATTATTATCTTTACCTGTATTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cleorodes lichenaria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cleorodes lichenaria

The Brussels Lace (Cleorodes lichenaria) is a moth of the family Geometridae. The species can be found in Europe.

Caterpillar

The wingspan is 31–38 mm. The length of the forewings is 14–18 mm. The moths fly in one generation from June to August. [1].

The larvae feed on lichens.

Notes[edit]

  1. ^ The flight season refers to Belgium and the Netherlands. This may vary in other parts of the range.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!