Overview

Distribution

The invasive species Tricellaria inopinata probably originates from the North Pacific Ocean. It was first described from the lagoon of Venice, in 1985. Since then it has spread over much of the north-east Atlantic Ocean.
  • De Blauwe, H.; Faasse, M. (2001). Extension of the range of the Bryozoans Tricellaria inopinata and Bugula simplex in the north-east Atlantic ocean (Bryozoa: Cheilostomatida). Ned. Faunist. Meded. 14: 103-112
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Deze geïntroduceerde soort is heel algemeen in jachthavens in België en Zeeland, vooral in augustus en september, waar ze groeit op pontons, scheepshuiden, Sargassum, Codium, touw, mosselschelpen, … Sterk uitbreidende soort die aan alle kusten te verwachten is, voornamelijk in jachthavens, maar ook in het infralitoraal. Spoelt al aan op plastic en wieren (De Blauwe (2002, 2003a), de Ruijter (2008)). Deze soort werd voor het eerst in Nederland opgemerkt in het Goesse Meer in augustus 2000. Het was dan al de algemeenste mosdiersoort in de jachthaven van Breskens. Er wordt vermoed dat Tricellaria inopinata afkomstig is uit het oosten van de Stille Oceaan. De soort komt inderdaad overeen met de beschrijving van Menipea (Tricellaria) occidentalis catalinensis beschreven van de westkust van de Verenigde Staten door Alice Robertson in 1905. De eerste Europese waarneming komt van Venetië waar de soort als nieuw werd beschreven. Later volgen waarnemingen van de Atlantische Oceaan (Noord-Spanje), Zuid-Engeland en tenslotte Nederland, België en Frankrijk. Tricellaria inopinata koloniseert in ijltempo de jachthavens van Europa (De Blauwe & Faasse, 2001).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

Opgerichte vertakte kolonies, vastgehecht met rhizoïden. De takjes bestaan uit alternerende zoïden in 2 rijen. De eerste zoïden na een vertakking hebben een chitineuze verbinding. Zoïden langwerpig, proximaal smal, distaal een ovale frontale membraan. 3 stekels op de buitenste distale hoek, de meest proximale daarvan meestal op het einde gevorkt. 2 of 3 stekels op de distale binnenhoek. Een scutum, vaak gelobd als een elandgewei, bedekt slechts de proximale helft van het frontale membraan (bij Scrupocellaria reptans bijna geheel). Het scutum is echter variabel: het kan een gaaf plaatje zijn, of gelobd in 2, 3 of 4 delen. Polypide met 13 tentakels. Avicularia groot, zo breed als een zoïde, lateraal, driehoekig, met op de distale zijde een mandibel. Geen frontale avicularia. Bij Scrupocellaria reptans komen geen zulke grote laterale avicularia voor. Broedkamers bolvormig, even lang als breed, met duidelijke poriën, die onderling verbonden zijn door lijntjes. Roze embryo’s. Losgelaten larve geel met enkele rozerode stipjes. Ancestrula een klein kommetje met 10 lange stekels rond een frontaal membraan.
  • De Blauwe, H. (2009). Mosdiertjes van de Zuidelijke Bocht van de Noordzee. Determinatiewerk voor België en Nederland. Uitgave Vlaams Instituut voor de Zee, Oostende: 464pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0.5 - 0.5
  Temperature range (°C): 11.597 - 11.597
  Nitrate (umol/L): 6.602 - 6.602
  Salinity (PPS): 34.849 - 34.849
  Oxygen (ml/l): 6.474 - 6.474
  Phosphate (umol/l): 0.484 - 0.484
  Silicate (umol/l): 3.994 - 3.994
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Alien species

De Pacifische kust van Noord-Amerika is het oorspronkelijke verspreidingsgebied van het onverwacht mosdiertje Tricellaria inopinata. Via transport op scheepsrompen en/of schelpdierenimport kwam de soort naar Europa. Dit mosdiertje werd voor de eerste keer in Belgische wateren waargenomen in 2000, in de jachthavens van Blankenberge en Oostende. Sindsdien is het een heel algemene soort in de (jacht)havens van België en Europa in het algemeen. Hier en daar breidt de populatie zich uit buiten de havens waardoor het af en toe te ook vinden is op aangespoelde wieren en plastic op het strand.
  • VLIZ Alien Species Consortium
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Alien species

The Pacific coast of North America is the original distribution area of Tricellaria inopinata. The species came to Europe by transport on ship hulls and/or via the import of shellfish. It was first reported in Belgian waters in 2000, in the marinas of Blankenberge and Ostend. Since then, the species has become a common inhabitant of harbours in Belgium and Europe. Occasionally, some of the population extends outside the harbours, causing specimens to be found washed ashore on seaweeds or plastic.
  • VLIZ Alien Species Consortium
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tricellaria inopinata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GGAATAATTGGAAGAGGTCTAAGAGCCTTAATTCGTGTAGAATTAAGACAACCTGGAGGTTTAATGGGTAAT---GACCAACTCTATAATGTTATTGTAACTGCTCATGCTTTTATAATAATTTTTTTTATAGTTATACCAATTATAATTGGGGGATTTGGAAATTGACTAGTTCCCCTTATACTAGGTGCTCCCGATATAGCATTCCCTCGTCTAAATAATATAAGATTTTGATTACTCCCACCTGCCATTTGTTTACTGCTTATATCCTCTATAGTTGAAAGTGGGGCTGGTACGGGGTGAACTGTTTATCCTCCTTTATACTCAAATGTATCCATAGGGGAGCCTTGCTGTTATTTAGCTATTTTTTCATTACATCTTGCAGGAGTTTCTTCTATTTTAGGAGCAATTAACTTTATAACAACTGTAATCAATATGCGATCAGATAATATAACATTTATACGAATTACGCTTTTTACATGAGCTGTTTTCATTACAGCTATTTTATTACTACTATCTTTACCCGTTCTTGCTGGAGCAATTACTATATTATTAACAGATCGAAATTTAAATACT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tricellaria inopinata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!