Articles on this page are available in 1 other language: Spanish (13) (learn more)

Overview

Brief Summary

Biology

Reproduction is brought about by increases in day-length and in water temperature, with mating begins in the spring once the water temperature has risen above 15 °C. Females will spawn twice or more each season, producing up to 1000 eggs per spawning when fully grown. The male yabbie positions a spermatophore between the female's fourth and fifth pairs of walking legs, and the female breaks this open and fertilises her eggs with the contents. The small, green, oval eggs are then attached to the swimming legs where they take 19 – 40 days to hatch, depending on the water temperature (3). The hatchlings grow through three larval stages, moulting between each. Young yabbies moult every few days, pumping water under the new, soft shell to make room for growth. Once fully grown, the yabbies moult just once or twice a year. Freshly moulted crayfish are exhausted and vulnerable to predation due to the lack of protective covering (3). They may also loose legs during the moult - these are usually regenerated (2). The yabbie crayfish is omnivorous, feeding primarily on rotting vegetation, but is somewhat opportunistic, eating anything it comes across, including, on occasions, other yabbie crayfish. Cannibalism is not a normal state, however, occurring usually when there is insufficient natural food or when there are overcrowded conditions. They are nocturnal, being most active just after dusk and just before dawn. Predators include cormorants, herons, ibises, Murray cod, and Callop. Small, larval crayfish are also vulnerable to attack from other invertebrates (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This smooth-shelled crayfish usually varies in colour from olive-green to brown, but can also be blue, yellow, red or black depending on the habitat, location and individual (3). The head and internal organs of all crayfish are protected by the carapace and the six segments of the abdomen are individually encased with a flexible membrane between them to allow movement. Crayfish have a pair of large claws at the front end, followed by four pairs of walking legs and then four pairs of small swimming legs called swimmerets. These swimmerets are covered with fine hairs to which the female attaches her eggs. A central tail flap is surrounded by four other flaps that are used to move the crayfish rapidly through the water, as well as curling up to form a brood chamber. There are two eyes on the end of eyestalks, but the senses of touch and taste are far more important, and are perceived using a pair of large feelers (or antennae) and a pair of small, fine, centrally located feelers (or antennules) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

The yabbie crayfish is widely distributed throughout Australia, being present in most of Victoria and New South Wales, as well as southern Queensland, South Australia and parts of the Northern Territory (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This semi-aquatic freshwater crayfish is found in several habitats including low-lying swamp ground, streams, rivers and dams. It is dependent upon high oxygen levels in the water and ample vegetation. Muddy or silty-bottomed waterways provide murky water which provides some predator protection. Water temperatures of around 20 – 25 °C are ideal, but the yabbie crayfish can tolerate temperatures down to 1 °C and as high as 35 °C by entering partial hibernation (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cherax destructor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACGCAACGATGATTTTTTTCAACAAATCATAAAGATATTGGAACCTTATATTTCGTCTTCGGTGCCTGATCGGGCATAGTAGGCACCTCATTAAGATTAATTATCCGGGCAGAACTAGGGCAACCGGGCAGATTAATTGGAGACGACCAGATCTACAATGTAATCGTAACCGCCCATGCCTTCGTGATAATTTTCTTCATAGTTATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTTCCCCTAATGCTAGGGGCCCCGGATATAGCCTTCCCGCGAATAACTAACATAAGATTCTGACTCCTTCCCTTCTCACTCACACTACTATTAACAAGGGGAATAGTAGAAAGTGGGGTAGGGACAGGATGAACTGTCTACCCGCCCCTAGCAGCAAGAATTGCCCATGCGGGGGCCTCAGTTGACCTGGGAATTTTTTCTCTTCATTTGGCAGGGGTATCTTCTATTCTAGGCGCCGTAAATTTTATAACTACGGCAATCAATATACGAACAAGAGGTATGACCATAGACCGGATGCCTCTTTTTGTCTGATCAGTATTCATTACAGCCGTGCTACTCCTATTATCCCTCCCGGTTCTAGCCGGAGCTATTACTATACTACTTACAGATCGAAATTTAAATACAACATTCTTTGACCCGGCAGGTGGAGGGGATCCTGTCCTATATCAACACTTGTTCTGATTCTTTGGGCACCCGGAGGTCTATATTCTCATTCTCCCTGCTTTTGGCATAGTCTCCCATATTGTAACACAAGAGTCAGGCAAAAAAGAAGCCTTCGGGACTTTAGGGATAATCTATGCCATGACAGCAATCGGGATCCTGGGTTTCCTAGTATGGGCCCACCATATATTTACAGTGGGCATAGATGTTGACACCCGTGCGTATTTTACATCCGCAACTATAATTATTGCCATTCCCACCGGAATTAAAATCTTTAGATGACTGAGAACCCTACAGGGATCTCAATTCTCCTATTCGCCGTCCCTCCTCTGGACCCTAGGGTTTATTTTTCTATTTACGGTGGGTGGTCTAACGGGAGTAATTTTAGCTAACTCGTCAATTGATATTATTCTCCACGATACCTATTATGTTGTCGCGCACTTTCACTATGTGCTATCCATGGGGGCAGTCTTTGGGATCTTTGGCGGAATTGTTCACTGATTCCCCCTTTTTACCGGCCTCTCACTCAAACCAAGGTGACTAAAACCCCACTTCTTTGCCATATTCTCAGGAGTAAACCTAACCTTCTTTCCCCAGCATTTCCTGGGACTTAATGGTATACCACGACGATACTCTGACTACCCCGATGCTTATACATCATGAAATATCGTCTCATCAATCGGGTCCCTAATCTCCTTAGTGGCAGTATTATGATTTATAATCATTGTCTGAGAAGCCTTTATATCCAAACGCCAAATCACGTCGCCATACTTTCTACCACCTTCAATCGAGTGGCAGCACCCGTGGCCCCCCGCAGACCATAGTTATTCAGAAATCCCACTAATCTCCAACT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cherax destructor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 25
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A1de

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Crandall, K.A.

Reviewer/s

Contributor/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Category: VU (Vulnerable)
 Criteria: A1de
  Conservation Links:   

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU - A1de) on the IUCN Red List 2003 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degradation of native vegetation and water pollution as a result of fertiliser and insecticide run-off from agricultural farms, as well as increase predation and competition from introduced non-native species put pressure on both the yabbie's ecosystem and the yabbie itself (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

The Australian Fisheries Management Act of 1994 designated the yabbie's ecosystem as an Endangered Ecological Community, requiring vegetation management, run-off control and extensive surveying, and without continued conservation efforts is under threat of irreversible degradation (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Common yabby

The common yabby (Cherax destructor) is an Australian freshwater crustacean in the Parastacidae family. It is listed as a vulnerable species[1] of crayfish by the World Conservation Union (IUCN), though the validity of this listing is questionable; wild yabby populations remain strong, and have expanded into new habitats created by reservoirs and farm dams.[2]

Its common name of "yabby" is also applied to many other Australian Cherax species of crustacean (as well as to marine ghost shrimp of the infra-order Thalassinidea). Yabbies occasionally reach up to 30 cm (12 in) in length but are more commonly 10–20 cm (4–8 in) long.[3]

Colour is highly variable and depends on water clarity and habitat; yabbies can range from black, blue-black or dark brown in clear waters to light brown, green-brown or beige in turbid waters.[4] Yabbies specifically bred to be a vibrant blue colour are now popular in the aquarium trade in Australia.

Ecology[edit]

Yabbies are common th Victoria and New South Wales, although the species also occurs in southern Queensland, South Australia androughout parts of the Northern Territory, making it the most widespread Australian crayfish.[5] It has been introduced to Western Australia, where it is an invasive species and poses a threat to other Cherax crayfish species native to the region, such as gilgies (Cherax quinquecarinatus).[6]

Yabbies are found in swamps, streams, rivers, reservoirs and farm dams at low to medium elevations. It appears yabbies were largely restricted to lower altitude habitats in inland areas of south-eastern Australia including the Murray-Darling Basin before European settlement, with the Euastacus spiny crayfish species found in higher altitude habitats and the coastal river systems. High altitude yabby populations in Lakes Eucumbene and Jindabyne, which are on the upper reaches of the coastal Snowy River system, are unusual and may be translocated.

Yabbies are found in many ephemeral waterways, and can survive dry conditions for long periods of time (at least several years) by aestivating (lying dormant) in burrows sunk deep into muddy creek and swamp beds.

Yabbies are primarily nocturnal detritivores, feeding primarily on algae and plant remains, at night, but also opportunistically feeding on any fish or animal remains they encounter at any time of day.

In Southern Australia it is commonly accepted that yabbies are active and thereby available to catch during the warmer months. (Colloquially any month with the letter "R" in it.) When temperatures fall below 16 °C (61 °F), they enter a state of reduced metabolic activity, or "partial hibernation".[5]

Yabbies are an important dietary item for Australian native freshwater fish like Murray cod and golden perch.

Catching[edit]

Catching yabbies, or "yabbying", in rivers and farm dams is a popular summertime activity in Australia, particularly with children. The most popular method involves tying a piece of meat to a few metres of string or fishing line, which in turn is fastened to a stick in the bank, and throwing the meat into the water. The string is pulled tight when a determined yabby grasps the meat in its claws and tries to make off with it. The line is then slowly pulled back to the bank, with the grasping yabby usually maintaining its hold on the meat. When the meat and the grasping yabby reaches the water's edge, a net is used to quickly scoop up both the meat and the grasping yabby in one movement.

Other methods of catching yabbies involve various types of nets and traps. Local fishing regulations must be checked before using any nets and traps for yabbies; many types of nets and traps are banned as wildlife such as platypus, water rats and long-necked turtles can become trapped in them and drown.

Aquaculture[edit]

Week-old yabby eggs, 2-3mm, attached by minute hairs to underside of female abdomen, CSIRO

The common yabby is a popular species for aquaculture,[5] although their burrowing can destroy dams.

Yabbies can also be found in private property dams where permission to fish must be obtained. Bag limits apply to yabbies in most states. For example in South Australia [7] it is illegal to catch over 200 yabbies a day. All females carrying eggs under their tails must be returned to the water.

Yabbies as food[edit]

While less common than prawns and other crustaceans, yabbies are eaten in Australia much like crayfish in other countries. Usually yabbies are boiled and eaten plain or with condiments. Yabbies are also occasionally served at restaurants, where they may be prepared in salads, ravioli, pasta, etc.

In New South Wales, yabbies can be seen sold live at some fish markets such as Sydney Fish Market. In Victoria, whole yabbies can be purchased cooked and ready to eat at Queen Victoria Market.

References[edit]

  1. ^ K. A. Crandall (1996). "Cherax destructor". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved 11 May 2006.  Listed as Vulnerable (VU A1de v2.3).
  2. ^ "Yabby". Native Fish Australia. 20 September 2006. 
  3. ^ Craig Williams. "Cherax destructor". 
  4. ^ Chris Goerner. "Cherax destructor". 
  5. ^ a b c Fiona Withnall (2000). "Biology of Yabbies (Cherax destructor)" (PDF). 
  6. ^ Beatty, S., D. Morgan & H. Gill (2005). "Role of Life History Strategy in the Colonisation of Western Australian Aquatic Systems by the Introduced Crayfish Cherax destructor Clark, 1936". Hydrobiologia 549 (1): 219–237. doi:10.1007/s10750-005-5443-0. 
  7. ^ "PIRSA Fisheries - Yabbie". 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!