Overview

Brief Summary

Characteristics

Characteristics:

Wing expanse 20-27 mm. Forewing white; hindwing dark grey with brown tinge, darkest by fore edge and apex, gradually lighter toward back corner. Male genitalia with aedeagus 1.45-1.70 mm long, 0.09-0.10 mm in cross section; female genitalia with posterior apophyses 4.1-4.5 mm long, large corpus bursae with signa 1.44-1.72 mm in diameter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Leptree.net

Source: LepTree

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Type

Holotype in USNM.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comparison with Similar Species

Fairly similar to elatella, with which it shares a distinctive ovipositor shape (a high dorsal ridge). Genitalia are characteristic for identification; a diagnostic key is provided.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographic Distribution

North central Florida and adjacent Georgia.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Adult Characteristics

Wing expanse 20-27 mm. Forewing white; hindwing dark grey with brown tinge, darkest by fore edge and apex, gradually lighter toward back corner. Male genitalia with aedeagus 1.45-1.70 mm long, 0.09-0.10 mm in cross section; female genitalia with posterior apophyses 4.1-4.5 mm long, large corpus bursae with signa 1.44-1.72 mm in diameter.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Tegeticula cassandra Pellmyr, 1999
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Female;
Preparation: Pinned
Collector(s): O. Pellmyr
Year Collected: 1998
Locality: 3.5 E Lake Placid (NE Archbold Biol.), N of Highlands Ave., Highlands Co, Florida, United States
Elevation (m): 20
  • Holotype: Pellmyr, O. 1999. Systematic Entomology. 24 (3): 258.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat:

Natural habitats include relatively open pine and pine-oak forests, and open grassy areas with oak scrub. Altitude 0-30 m.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Leptree.net

Source: LepTree

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Natural habitats include relatively open pine and pine-oak forests, and open grassy areas with oak scrub. Altitude 0-30 m.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Host, Oviposition, and Larval Feeding Habits

The species is known from the capsular-fruited Yucca filamentosa (Y. smalliana, Y. flaccida) and probably the fleshy-fruited Y. aloifolia. Eggs are laid just below the ovary surface, usually at the base of the style. The larva feeds on developing seeds. Pupation occurs in a cocoon in the soil.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tegeticula cassandra

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 50 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCATAAAGATATTGGAACTTTATATTTTATTTTTGGAATTTGATCAGGAATAATTGGTACTTCTTTAAGTTTACTTATTCGAGCAGAACTAGGAACTCCTGGGGCATTAATTGGAGAT---GATCAAATTTATAATACAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGAAATTGACTTGTTCCTTTAATATTAGGAGCTCCTGATATAGCATTTCCACGATTAAATAATATAAGATTTTGATTACTTCCCCCATCATTAATTTTATTAATTTCAAGTAGATTAGTCGAAAATGGAGCAGGAACAGGATGAACAGTATATCCCCCTTTATCATCAAATATTACTCATTCTGGAAGTTCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCCGGAATTTCCTCAATTTTAGGAACTGTAAATTTTATTACTACAGTAATTAATATACGACCAGTTAATATAACATTTGATAGAATACCTTTATTTGTTTGAGCAGTTGCTATTACAGCTTTACTTCTTCTTTTATCATTACCTGTATTAGCAGGAGCTATTACAATATTATTAACAGATCGAAACTTAAATACATCTTTTTTTGATCCTGCTGGAGGTGGGGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCGGGATTTGGTATAATTTCACATATTATTAGTCAAGAAAGAGGTAAAAAAGAAACTTTTGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tegeticula cassandra

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 50
Specimens with Barcodes: 52
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tegeticula cassandra

Tegeticula cassandra is a moth of the Prodoxidae family. It is found in north-central Florida and bordering areas of Georgia. The habitat consists of open pine and pine-oak forests and open grassy areas with oak scrub.

The wingspan is 20–27 mm. The forewings are white and the hindwings are dark grey with a brown tinge.[1]

The larvae feed on Yucca filamentosa, Yucca smalliana, Yucca flaccida and possibly Yucca aloifolia. They feed on developing seeds. Pupation takes place in a cocoon in the soil.

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!