Overview

Brief Summary

Introduction

Introduction:

The genus Adelpha is a diverse radiation of neotropical limenitidines. Many are brown with orange forewing patches and white stripes, and it is suggested that there is mimicry among geographically sympatric species. The genus has been revised recently by Willmott (2003a, b).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Leptree.net

Source: LepTree

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Introduction

The genus Adelpha is a diverse radiation of neotropical limenitidines. Many are brown with orange forewing patches and white stripes, and it is suggested that there is mimicry among geographically sympatric species. The genus has been revised recently by Willmott (2003a, b). Although Willmott recognizes a number of groups based on similarity of wing patterns, only those species groups that appear as clades in his phylogenetic analysis are indicated here.

Two additional species of Adelpha were recently split out of the widespread "California sister," Adelpha bredowii (now recognized as a Mexican endemic) by Prudic et al. (2008).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Discussion of Phylogenetic Relationships

View Adelpha Tree

The tree shown is based on the phylogenetic analysis of morphological characters by Willmott (2003), using successive approximations weighting (his Fig. 8). Adelpha californica (from California and the Pacific Northwest) and Adelpha eulalia (ranging from southwestern U. S. to Guatemala) have been added to the tree in the positions indicated by Prudic et al. (2008).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:1,005Public Records:665
Specimens with Sequences:891Public Species:47
Specimens with Barcodes:835Public BINs:26
Species:89         
Species With Barcodes:73         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Adelpha celerioDHJ01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Adelpha basiloidesDHJ01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Adelpha basiloidesDHJ02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 47
Specimens with Barcodes: 144
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Adelpha celerioDHJ02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 46
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Adelpha Janzen01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Adelpha laciniaDHJ01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Adelpha basiloidesDHJ01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGTGTTGAATTAGGAAACCCAGGCTCTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCCCTTATACTAGGAGCCCCAGATATAGCCTTCCCCCGTATAAATAATATAAGATTTTGACTTCTACCTCCTTCTTTAATTTTATTAATTTCGAGTAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCACCCCTTTCATCTAATATCGCTCATGGAGGATCTTCAGTTGATCTAGCTATTTTTTCCCTACATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATGCGAGTTAATAATATATCTTATGATCAAATACCTTTATTTGTGTGATCAGTAGTTATTACAGCTCTTTTATTATTACTATCTCTTCCAGTATTAGCAGGAGCTATTACTATACTTTTAACAGATCGTAATTTAAATACCTCTTTTTTTGATCCTGCTGGAGGAGGGGATCCTATTTTATACCAACATTTGTTTTGATNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Adelpha basiloidesDHJ02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 135 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGTGTTGAATTAGGAAACCCAGGTTCTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCCCTTATACTAGGAGCCCCAGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGACTTCTACCCCCCTCTTTAATTTTATTAATTTCGAGTAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCACCCCTTTCATCTAATATCGCTCATGGAGGATCTTCAGTTGATCTAGCCATTTTTTCTCTACATTTAGCCGGAATTTCATCAATTTTAGGGGCAATTAATTTTATTACAACTATTATTAATATACGAGTTAATAATATATCTTATGATCAAATACCTTTATTTGTGTGATCAGTAGGTATTACAGCTCTTTTATTATTATTATCTCTTCCAGTATTAGCGGGAGCTATTACTATACTTTTAACAGATCGTAATTTAAATACATCTTTTTTTGACCCTGCTGGAGGAGGAGACCCTATTTTATATCAACATTTATTTTGATNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Adelpha laciniaDHJ02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTTCTTTAAGTTTATTAATTCGAGTAGAATTAGGTAACCCAGGTTCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATANTTTTTTTTATGGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTCTTATGTTAGGGGCCCNAGATATAGCTTTCCCCCGTATAAATAATATGAGATTTTGACTTTTACCTCCTTCTTTAATTTTATTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCACCCCTTTCATCTAATATTGCTCATGGAGGATCTTCAGTTGATTTAGCTATTTTTTCCTTACATTTAGCTGGTATTTCATCAATTTTAGGAGCAATTAACTTTATTACAACTATTATTAATATGCGAGTTAATAACATATCTTATGATCAAATACCCCTATTTGTTTGATCTGTTGGTATTACAGCTCTTCTTTTATTATTATCCTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACTTCTTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Adelpha laciniaDHJ02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Adelpha laciniaDHJ01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 23 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACTTTATATTTTATTTTTGGAATTTGAGCCGGAATAGTGGGGACTTCTTTAAGTTTATTAATTCGAGTAGAATTAGGTAACCCAGGCTCTTTAATTGGCGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGGTTTGGAAATTGATTAGTTCCTCTTATATTAGGAGCCCCAGATATAGCTTTCCCCCGTATAAATAACATAAGATTTTGACTTTTACCTCCTTCTTTAATCTTATTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCACCCCTTTCATCTAATATTGCCCATGGAGGATCTTCAGTTGATTTAGCTATTTTTTCCTTACATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACTATCATTAATATACGAGTTAATAATATATCTTATGATCAAATACCTCTATTTGTTTGATCTGTTGGTATTACAGCTCTTCTTTTATTATTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGACCGTAACTTAAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTTTGATNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Adelpha celerioDHJ02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 44 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATAAATAATATAAGATTTTGACTTTTACCCCCATCTTTAATTTTACTTATTTCAAGTAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAATATCGCCCATGGAGGCTCCTCCGTTGATTTAGCTATTTTTTCCCTACATTTAGCTGGTATTTCCTCAATTTTAGGAGCAATTAATTTCATTACAACTATTATTAATATACGAGTTAATAATATATCTTATGATCAAATACCCTTATTTGTTTGATCAGTAGGAATTACTGCTCTTTTATTACTATTATCATTACCTGTATTAGCAGGAGCTATTACTATACTTTTAACAGACCGTAATTTAAATACTTCCTTCTTTGACCCNGCCGGAGGAGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Adelpha celerioDHJ01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACTTTATATTTTATTTTTGGAGTATGAGCCGGAATAGTTGGTACTTCTTTAAGTTTACTAATTCGAGTTGAATTAGGAAATCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTCCCTCTTATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCATCTTTAATTTTACTTATTTCAAGTAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAATATCGCCCATGGAGGCTCCTCCGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATTTCCTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAGTTAATAATATATCTTATGATCAAATACCTTTATTTGTTTGATCAGTAGGAATTACTGCTCTTTTATTACTATTATCCTTACCTGTATTAGCAGGAGCTATTACTATACTTTTAACAGACCGTAATTTAAATACTTCCTTCTTTGACCCCGCCGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Adelpha basiloidesPRH01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Adelpha basiloidesECO01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGTGTTGAATTAGGAAACCCAGGCTCTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTTATACTAGGAGCCCCAGATATAGCCTTCCCCCGTATAAATAATATAAGATTTTGACTTCTACCTCCTTCTTTAATTTTATTAATTTCGAGTAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCACCCCTTTCATCTAATATCGCTCATGGAGGATCTTCAGTTGATCTAGCTATTTTTTCCCTACATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATGCGAGTTAATAATATATCTTATGATCAAATACCTTTATTTGTGTGATCAGTAGTTATTACAGCTCTTTTATTATTACTATCTCTTCCAGTATTAGCAGGAGCTATTACTATACTTTTAACAGATCGTAATTTAAATACCTCTTTTTTTGATCCTGCTGGAGGAGGGGATCCTATTTTATACCAACATTTGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Adelpha basiloidesECO01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Adelpha basiloidesECO02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGTGTTGAATTAGGAAACCCAGGTTCTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCCCTTATACTAGGAGCCCCAGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGACTTCTACCCCCCTCTTTAATTTTATTAATTTCGAGTAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCACCCCTTTCATCTAATATCGCTCATGGAGGATCTTCAGTTGATCTAGCCATTTTTTCTCTTCATTTAGCCGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAGTTAATAATATATCTTATGATCAAATACCTTTATTTGTGTGATCAGTAGGTATTACAGCTCTTTTATTATTATTATCTCTTCCAGTATTAGCGGGAGCTATTACTATACTTTTAACAGATCGTAATTTAAATACATCTTTTTTTGACCCTGCTGGAGGAGGAGACCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Adelpha basiloidesECO02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Adelpha

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Adelpha

Adelpha is a genus of brush-footed butterflies found in southern USA and Mexico to South America. They are commonly known as sisters, due to the white markings on their wings, which resemble a nun's habit.[1] This genus is sometimes included with the admiral butterflies (Limenitis).

Species[edit]

Listed alphabetically within species group.[2][3]

The adala species-group:

The capucinus species-group:

The cocala species-group:

The iphiclus species-group:

The phylaca species-group:

The serpa species-group:

Ungrouped:

See also[edit]

  • Doxocopa - A genus of butterflies whose females closely resemble Adelpha species

References[edit]

  1. ^ National Audubon Society (1981). Robert Michael Pyle, ed. The Audubon Society field guide to North American butterflies. Knopf. ISBN 9780394519142. 
  2. ^ Adelpha, funet.fi
  3. ^ Jeffrey Glassberg (2007). A Swift Guide to the Butterflies of Mexico and Central America. Sunstreak Books Inc. ISBN 978-1-4243-0915-3. pp.97-101.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!