Overview

Brief Summary

Introduction

This attractive species is native to southeast Asia, ranging from India to the Philippines, to northwesten Australia. It is involved in Müllerian mimicry rings with several othe Danaus species.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Summary

"Danaus genutia, or the Common Tiger, from the Danainae group of the Brush –footed Butterfly families is one of the most common Indian butterflies. Also called the Striped Tiger to distinguish it from the equally common Plain Tiger Danaus chrysippus, this attractive species is involved in Mullerian mimicry rings with several Danaus species."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nomenclature

Linnaeus conflated this species with the monarch, resulting in nomenclatural confusion as to which species is "Danaus plexippus" that persisted from 1758 until 1954, when the International Commission of Zoological Nomenclature finally ruled that the name is correctly applied to the latter species.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"Adults: Both sexes of the butterfly have tawny wings with veins marked with broad black bands. Upper sides of forewings: costal and dorsal margins and apical half of wing black. Cell in interspaces 1 and 2 and a spot at base of interspace 3 tawny red. Three white spots above and beyond apex of cell followed by a pre-apical white band crossed by the veins; an incomplete sub-terminal and terminal series of white spots. Hindwing: tawny-red, veins, and terminal margin black; the latter with two more or less complete rows of white spots. The underside of the wings resembles the upperside but is paler in colouration. In drier regions, the tawny part of the hindwing pales becoming almost white in colour. This form of the Common Tiger looks very similar to the White Tiger (D. melanippus). The male Common Tiger has a prominent black-and-white spot on the underside of the hindwing. Caterpillar: Black, marked with bluish-white and yellow spots and lines, and three pairs of tentacles on its body. Chrysalis/Pupa: Green and marked with golden yellow spots."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Wingspan 70-100 mm.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

SubSpecies Varieties Races

"Sixteen subspecies: • Danaus genutia genutia (India to China, Sri Lanka, Andamans, Nicobars, Peninsular Malaya, Thailand, Langkawi, Singapore, Indo-China, Taiwan, Hainan) • Danaus genutia sumatrana Moore, 1883 (western and north-eastern Sumatra) • Danaus genutia intermedia (Moore, 1883) • Danaus genutia conspicua Butler, 1866 (southern Sulawesi) • Danaus genutia niasicus Fruhstorfer, 1899 (Nias) • Danaus genutia intensa (Moore, 1883) (Java, Bali, Bawean, Borneo) • Danaus genutia partita (Fruhstorfer, 1897) (Lesser Sunda) • Danaus genutia leucoglene C. & R. Felder, 1865 (northern Sulawesi) • Danaus genutia tychius Fruhstorfer, 1910 (Selajar) • Danaus genutia telmissus Fruhstorfer, 1910 (Butong Island) • Danaus genutia wetterensis (Fruhstorfer, 1899) (Wetar Island, Timor) • Danaus genutia laratensis (Butler, 1883) (Tanimbar Island) • Danaus genutia kyllene Fruhstorfer, 1910 (Damar Island, Kai Island) • Danaus genutia alexis (Waterhouse & Lyell, 1914) (Northern Territory to north-western Australia)"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

"Closely resembles Monarch butterfly Danaus plexippus of the Americas. The Striped Tiger is mimicked by both sexes of the Indian Tamil Lacewing Cethosia nietneri mahratta and the Leopard Lacewing Cethosia cyane, and, females of the Common Palmfly Elymnias hypermnestra."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

General Habitat

"Scrub jungles, fallowland adjacent to habitation, dry and moist deciduous forests, preferring areas of moderate to heavy rainfall. Also occurs in degraded hill slopes and ridges, both, bare or denuded, and, those covered with secondary growth."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

"In peninsular India, the Common Tiger caterpillar most commonly feeds on small herbs, twiners and creepers from the family Asclepiadaceae. These include Asclepias curassavica, Ceropegia intermedia, Cynanchum dalhousieae, Raphistemma pulchellum, Stephanotis spp. (including S. floribunda?) and Tylophora tenuis. Butterflies nectar on the flowers of Adelocaryum, Cosmos, Celosia, Lantana, Zinnia and similar flowers."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

"In the South Asian part of its range it is fairly common, locally very common."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

"Common Tigers have leathery bodies, are tough to kill and can fake death when threatened. Caterpillars of the Common Tiger feed on poisonous plants sequestering poison in the bodies of their adult forms. Butterflies also congregate with other Danaiines to sip the sap of Crotolaria, Heliotropium and other plants which contain the pyrrrolizidine alkaloids which the butterflies sequester. A study in Northeastern India showed a preference in these butterflies to foraging on Crotalaria juncea compared to Bauhinia purpurea, Barleria cristata rosea and Nerium oleander. The sequestered alkaloids make both the caterpillars and butterflies of Common Tiger distasteful to predators. To advertise their unpalatability, the butterfly has prominent markings with a striking colour pattern. While Common Tigers are strong fliers, with faster and more powerful strokes than the Plain Tiger, they never fly rapidly or high when it ranges forth in search of its host and nectar plants."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

"Eggs laid singly on the underside of leaves of host plants. Caterpillars feed on their eggshells first, followed by leaves and vegetative parts of the host plant."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

"Its evolutionary relationships are not completely resolved, but it appears to be closest to the Malay Tiger (D. affinis) and White Tiger."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Danaus genutia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Danaus genutia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TCATTAATCTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGCTCATGGAGGATCTTCAGTAGATTTAGCTATTTTTTCTTTACACTTAGCTGGAATTTCTTCTATTTTAGGTGCTATTAATTTTATTACAACAATTTTAAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGGTATTACTGCTCTTCTTTTATTACTTTCATTACCTGTTTTAGCAGGAGCAATTACTATACTTCTTACGGATCGAAATTTAAATACTTCATTTTTTGATCCTGCTGGTGGAGGAGATCCAATTTTATACCAACACTTATTCTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGAATAATTTCTCATATTATTTCTCAAGAAAGAGGAAAAAAAGAAACTTTTGGATCTTTAGGAATAATTTATGCTATAATAGCAATTGGATTACTTGGATTTATTGTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Common
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Danaus genutia

"Common Tiger" redirects here. For for the species of dragonfly in family Gomphidae, see Common Tiger (dragonfly).

The Common Tiger (Danaus genutia) is one of the common butterflies of India. It belongs to the "Crows and Tigers", that is, the danainae group of the Brush-footed butterflies family. The butterfly is also called Striped Tiger in India to differentiate it from the equally common Plain Tiger Danaus chrysippus.[1]

Description[edit]

The butterfly closely resembles the Monarch butterfly (Danaus plexippus) of the Americas. The wingspan is 75 to 95 mm. Both sexes of the butterfly have tawny wings with veins marked with broad black bands. The female[verification needed] has a pouch on the hindwing.[2] The margins of the wings are black with two rows of white spots. The underside of the wings resembles the upperside but is paler in colouration. The male Common Tiger has a prominent black-and-white spot on the underside of the hindwing.[1] In drier regions the tawny part of the hindwing pales and approaches white in colour making it very similar to the White Tiger (D. melanippus).[2]

Distribution and ecology[edit]

D. genutia is distributed throughout India, Sri Lanka, Myanmar and extending to South East Asia and Australia (except New Guinea).[1] At least in the South Asian part of its range it is fairly common, locally very common.[2] This butterfly occurs in scrub jungles, fallowland adjacent to habitation, dry and moist deciduous forests, preferring areas of moderate to heavy rainfall. Also occurs in degraded hill slopes and ridges, both, bare or denuded, and, those covered with secondary growth.[1] While it is a strong flier, it never flies rapidly or high. It has stronger and faster strokes than the Plain Tiger. The butterfly ranges forth in search of its host and nectar plants. It visits gardens where it nectars on the flowers of Adelocaryum, Cosmos, Celosia, Lantana, Zinnia and similar flowers.[1]

Defence against predators, mimicry[edit]

Members of this genus are leathery, tough to kill and fake death. Since they are unpleasant to smell and taste, they are soon released by the predators, recover and fly off soon thereafter. The butterfly sequesters toxins from its foodplants of the family Asclepiadaceae. The butterflies also congregate with other danaiines to sip from the sap of Crotolaria, Heliotropium and other plants which provide the pyrrrolizidine alkaloids which they sequester.[1] A study in Northeastern India showed a preference to foraging on Crotalaria juncea compared to Bauhinia purpurea, Barleria cristata rosea and Nerium oleander.[3] To advertise their unpalatability, the butterfly has prominent markings with a striking colour pattern. The Striped Tiger is mimicked by both sexes of the Indian Tamil Lacewing Cethosia nietneri mahratta and the Leopard Lacewing Cethosia cyane and females of the Common Palmfly Elymnias hypermnestra.[4]

Life history[edit]

Upperside pattern

This butterfly lays its egg singly under the leaves of any of its hostplants of family Asclepiadaceae. The caterpillar is black and marked with bluish-white and yellow spots and lines. It has three pairs of tentacles on its body. It first eats the eggshell and then proceeds to eat leaves and vegetative parts of the plant. The chrysalis (pupa) is green and marked with golden yellow spots.[1]

Gallery[edit]

Food plants[edit]

The caterpillar of the Common Tiger butterfly obtains a supply of poison by eating poisonous plants, which makes the caterpillar and butterfly a distasteful morsel for predators. The most common foodplants of the Common Tiger in Peninsular India are small herbs, twiners and creepers from the family Asclepiadaceae, including:

Subspecies[edit]

It has some 16 subspecies; its evolutionary relationships are not completely resolved, but it appears to be closest to the Malay Tiger (D. affinis) and White Tiger.[6]

See also[edit]

References[edit]

  • Bhuyan, M.; Deka, M.; Kataki, D. & Bhattacharyya, P. R. (2005): Nectar host plant selection and floral probing by the Indian butterfly Danaus genutia (Nymphalidae). Journal of Research on the Lepidoptera 38: 79-84. PDF fulltext
  • Evans, W.H. (1932) The Identification of Indian Butterflies. (2nd Ed), Bombay Natural History Society, Mumbai, India.
  • Kunte, Krushnamegh (2000) Butterflies of Peninsular India, Universities Press (India) Ltd, Hyderabad (reprint 2006). ISBN 81-7371-354-5
  • Smith, David A. S.; Lushai, Gugs & Allen, John A. (2005): A classification of Danaus butterflies (Lepidoptera: Nymphalidae) based upon data from morphology and DNA. Zool. J. Linn. Soc. 144(2): 191–212. doi:10.1111/j.1096-3642.2005.00169.x (HTML abstract)
  • Wynter-Blyth, M. A. (1957): Butterflies of the Indian Region. Bombay Natural History Society, Mumbai, India.

Footnotes[edit]

  1. ^ a b c d e f g h i j k Kunte (2000): 45, pp. 148-149.
  2. ^ a b c Wynter-Blyth (1957): p. 69.
  3. ^ Bhuyan et al. (2005)
  4. ^ Wynter-Blyth 1957): p. 56.
  5. ^ a b c d Wynter-Blyth (1957): p. 493.
  6. ^ Smith et al. (2005)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!