Molecular Biology and Genetics

Molecular Biology

Barcode data: Aspitates gilvaria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGGGTTTGAGCTGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGATCTTTAATTGGGGACGATCAAATTTATAATACTATTGTAACAGCCCACGCTTTTATTATAATTTTTTTTATGGTTATACCAATTATAATTGGCGGATTTGGAAATTGATTAGTACCTTTAATACTTGGAGCACCTGATATAGCTTTTCCACGAATAAACAATATAAGATTTTGATTACTCCCCCCATCCATCACATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACTGTTTACCCACCTTTATCATCAAATATTGCACATGGGGGTAGTTCTGTAGATTTAGCTATTTTCTCACTTCATTTAGCTGGTATTTCATCAATCTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGTTTAAATAACATATCATTTGATCAAATACCTCTATTTGTTTGAGCTGTAGGTATTACAGCATTCTTATTATTACTTTCCCTACCAGTATTGGCAGGAGCTATTACTATATTATTAACTGATCGAAACTTAAATACATCATTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aspitates gilvaria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Aspitates gilvaria

The Straw Belle (Aspitates gilvaria) is a moth of the Geometridae family. It is found from Europe to the eastern part of the Palearctic ecozone.

The wingspan is 25–30 mm.The graduated buff colour forewing has a red or brown diagonal slash from the wing tip to the inside edge.The hindwings are white with a faint diagonal grey streak and a dot on the upper surface. The male has combed antennae. The female is more mottled than the male and has less combed antennae.

Adults are on wing from July to August.

The larvae feed on various herbaceous plants, including Potentilla, Thymus, Andromeda polifolia and possibly Empetrum nigrum, Rubus chamaemorus and Vaccinium uliginosum.

Subspecies[edit]

Gallery[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!