Overview

Brief Summary

The galah (Eolophus roseicapilla) is a small pink and grey cockatoo, 24-40 centimetres in length and 227-380 grams in weight. The sexes look alike, but the eyes of the male are dark brown, while those of the female are pinkish-red. It is the most widespread and abundant of the Australian cockatoos and is found throughout the interior areas of the Australian mainland. The original habitat of the galah was chiefly inland semi-arid shrublands and drier coastal areas to the north. The birds were typically found along watercourses with suitable nesting and roosting trees.

Galahs are sociable birds, often seen in flocks of more than 100 individuals. Flocks of up to 2,000 have also been recorded. They forage mostly on the ground for seeds. Hollows in living or dead eucalypts trees near a water source are used for nesting. When hollows are scarce, galahs will also use cliffs or steel pipes used for gate posts.

  • Western Australia Department of Environment and Conservation Fauna Notes, Galah, link, accessed 7 April 2012
Public Domain

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 40 years (captivity) Observations: One specimen lived 40 years in captivity (Flower 1938).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eolophus roseicapilla

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCGGACCGCCCTAAGCTTGCTCATCCGCGCAGAACTCGGYCAGCCAGGAACCTTACTAGGAGACGACCAAATTTACAATGTAATCGTTACTGCCCATGCTTTCGTAATAATCTTTTTCATAGTAATACCAATCATAATCGGAGGATTTGGGAACTGACTGGTGCCCCTTATAATTGGTGCTCCCGATATAGCATTCCCACGCATAAACAACATAAGCTTCTGGCTCCTCCCTCCCTCCTTCCTTCTCCTACTAGCCTCATCCACAGTTGAGGCCGGAGCAGGTACAGGGTGAACTGTCTACCCACCCCTAGCCGGAAACCTAGCCCATGCTGGAGCATCAGTAGACCTAGCTATTTTTTCCCTCCATTTAGCAGGTGTATCTTCCATCCTAGGAGCTATCAACTTCATCACCACTGCCATTAACATAAAACCACCCGCCCTATCACAATATCAAACCCCACTATTTGTTTGATCTGTCCTCATTACCGCCGTGCTACTTCTACTATCCCTCCCAGTCCTAGCTGCTGGCATTACCATACTCCTCACAGACCGTAACCTAAACACCACATTCTTTGACCCCGSAGGAGGAGGAGACCCAGTCCTATACCAACACCTCTTCTGATTCTTTGGTCACCCAGAAGTATACATCCTCATCCTCCCTGGATTCGGAATCATCTCACATGTAGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eolophus roseicapilla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as common (del Hoyo et al. 1997).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Galah

The Galah /ɡəˈlɑː/, Eolophus roseicapilla, also known as the Rose-breasted Cockatoo, Galah Cockatoo, Roseate Cockatoo or Pink and Grey, is one of the most common and widespread cockatoos, and it can be found in open country in almost all parts of mainland Australia.

It is endemic on the mainland and was introduced to Tasmania,[1] where its distinctive pink and grey plumage and its bold and loud behaviour make it a familiar sight in the bush and increasingly in urban areas. It appears to have benefited from the change in the landscape since European colonisation and may be replacing the Major Mitchell's Cockatoo in parts of its range.

The term galah is derived from gilaa, a word found in Yuwaalaraay and neighbouring Aboriginal languages.[2]

Description[edit]

Female, note reddish eye

Galahs are about 35 cm (14 in) long and weigh 270–350 g. They have a pale grey to mid-grey back, a pale grey rump, a pink face and chest, and a light pink mobile crest. They have a bone-coloured beak and the bare skin of the eye rings is carunculated. They have grey legs. The genders appear similar, however generally adult birds differ in the colour of the irises; the male has very dark brown (almost black) irises, and the female has mid-brown or red irises. The colours of the juveniles are duller than the adults. Juveniles have greyish chests, crowns, and crests, and they have brown irises and whitish bare eye rings, which are not carunculated.[3]

Distribution and habitat[edit]

A juvenile Galah feeding on a Metropolitan lawn in Sydney, Australia
Juvenile in Wamboin, NSW

Galahs are found in all Australian states, and are absent only from the driest areas and the far north of Cape York Peninsula. It is still uncertain whether they are native to Tasmania, though they are locally common today, especially in urban areas.[4] They are common in some metropolitan areas, for example Adelaide, Perth and Melbourne, and common to abundant in open habitats which offer at least some scattered trees for shelter. The changes wrought by European settlement, a disaster for many species, have been highly beneficial for the galah because of the clearing of forests in fertile areas and the provision of stock watering points in arid zones.

Flocks of galahs will often congregate and forage on foot for food in open grassy areas.

Classification[edit]

The classification of the Galah was difficult. It was separated in the monotypic genus Eolophus, but the further relationships were not clear. There are obvious morphological similarities between the Galah and the white cockatoos that make up the genus Cacatua and indeed the Galah was initially described as Cacatua roseicapilla. Early DNA studies allied the Galah with the Cockatiel or placed it close to some Cacatua species of completely different appearance. In consequence, it was thought that the ancestors of the Galah, the Cockatiel and Major Mitchell's Cockatoo diverged from the main white cockatoo line at some stage prior to that group's main radiation; this was indeed correct except for the placement of the Cockatiel. Ignorance of this fact, however, led to attempts to resolve the evolutionary history and prehistoric biogeography of the cockatoos, which ultimately proved fruitless because they were based on invalid assumptions[more information needed] to start with.[citation needed]

It fell to the study of Brown & Toft (1999) to compare the previously available data with their mitochondrial 12S rRNA sequence[clarify] research and resolve the issue. Today, the Galah is seen, along with Major Mitchell's Cockatoo, as an early divergence from the white cockatoo lineage which have not completely lost their ability to produce an overall pink (Major Mitchell's) or pink and grey (galah) body plumage, while already being light in colour and non-sexually dimorphic. The significance of these two (and other) characteristics shared by the Cacatuinae had previously been explained away in earlier studies by strict application of parsimony on misinterpreted data.[clarify]

Subspecies[edit]

Three subspecies are usually recognised. There is slight variation in the colours of the plumage and in the extent of the carunculation of the eye rings among the three subspecies. The south-eastern form, E. r. albiceps, is clearly distinct from the paler-bodied Western Australian nominate subspecies, E. r. roseicapillus, although the extent and nature of the central hybrid zone remains undefined. Most pet birds outside Australia are the south-eastern form. The third form, E. r. kuhli, found right across the northern part of the continent, tends to be a little smaller and is distinguished from albiceps by differences in the shape and colour of the crest, although its status as a valid subspecies is uncertain.

Breeding[edit]

Female E. r. albiceps displaying her crest outside her nest in Tasmania, Australia

The Galah nests in tree cavities. The eggs are white and there are usually two or five in a clutch. The eggs are incubated for about 25 days, and both the male and female share the incubation. The chicks leave the nest about 49 days after hatching.[5]

Like most other cockatoos, Galahs create strong lifelong bonds with their partners.

Hybrids[edit]

A Galah x Corella hybrid.

Aviary-bred crosses of galahs and Major Mitchell's Cockatoos have been bred in Sydney, with the tapered wings of the galah and the crest and colours of the Major Mitchell's, as well as its plaintive cry. The Galah has also been shown to be capable of hybridising with the Cockatiel, producing offspring described by the media as 'Galatiels'.[6] Galahs are known to join flocks of Little Corellas (Cacatua sanguinea), and are known to breed with them also.[citation needed]

Cultural references[edit]

"Galah" is also derogatory Australian slang, synonymous with 'fool' or 'idiot'. Because of the bird's distinctive bright pink, it is also used for gaudy dress. A detailed, yet comedic description of the Australian slang term can be found in the standup comedy performance of Paul Hogan, titled Stand Up Hoges. Another famous user of the slang "galah" is Alf Stewart from Home and Away who is often heard saying "Flaming galah!" when he is riled by somebody.

The Australian representative team of footballers which played a series of test matches of International Rules Football against Irish sides in the late 1960s was nicknamed "The Galahs" (see "The Australian Football World Tour).

Namesake[edit]

References[edit]

  1. ^ Department of Primary Industries, Parks, Water and Environment
  2. ^ Dixon et al. (2006): p. 84.
  3. ^ Forshaw (2006). plate 3."
  4. ^ Sharland, Michael (1981). A Guide to the Birds of Tasmania. Hobart, Tasmania: Drinkwater. ISBN 0-949903-03-5. 
  5. ^ Alderton, David (2003). The Ultimate Encyclopedia of Caged and Aviary Birds. London, England: Hermes House. p. 205. ISBN 1-84309-164-X. 
  6. ^ Talking Birds – Australia's Avian Newspaper
  • Brown, D.M. & Toft, C.A. (1999): Molecular systematics and biogeography of the cockatoos (Psittaciformes: Cacatuidae). Auk 116(1): 141–157.
  • Flegg, Jim (2002): Photographic Field Guide: Birds of Australia. Reed New Holland, Sydney & London. ISBN 1-876334-78-9
  • Forshaw, Joseph M. & Cooper, William T. (2002): Australian Parrots (3rd ed.). Alexander Editions. ISBN 0-9581212-0-6
  • Frith, Harold James & Watts, Betty Temple (1984): Birds in the Australian High Country. Angus & Robertson, London. ISBN 0-207-14464-8

Cited texts[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!