Ecology

Habitat

Depth range based on 36 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 41.5 - 165
  Temperature range (°C): 18.458 - 24.703
  Nitrate (umol/L): 0.816 - 8.522
  Salinity (PPS): 35.354 - 35.445
  Oxygen (ml/l): 4.430 - 4.814
  Phosphate (umol/l): 0.120 - 0.453
  Silicate (umol/l): 1.236 - 4.413

Graphical representation

Depth range (m): 41.5 - 165

Temperature range (°C): 18.458 - 24.703

Nitrate (umol/L): 0.816 - 8.522

Salinity (PPS): 35.354 - 35.445

Oxygen (ml/l): 4.430 - 4.814

Phosphate (umol/l): 0.120 - 0.453

Silicate (umol/l): 1.236 - 4.413
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 2 - 457.2
  Temperature range (°C): 13.240 - 26.803
  Nitrate (umol/L): 0.090 - 13.071
  Salinity (PPS): 34.975 - 35.237
  Oxygen (ml/l): 4.666 - 4.850
  Phosphate (umol/l): 0.131 - 0.817
  Silicate (umol/l): 1.005 - 6.076

Graphical representation

Depth range (m): 2 - 457.2

Temperature range (°C): 13.240 - 26.803

Nitrate (umol/L): 0.090 - 13.071

Salinity (PPS): 34.975 - 35.237

Oxygen (ml/l): 4.666 - 4.850

Phosphate (umol/l): 0.131 - 0.817

Silicate (umol/l): 1.005 - 6.076
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Limaria fragilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTATTCCTTTATTGATTTCTTCTCCTGACATGATTTTTCCTCGTTTAAATAATTTTAGCTTTTGGTTGCTTCCCCCGGCGGCTTTTATAGCTATTGGTTCTATGGGTGTTGGAAGGGGTACAGGGGCTGGTTGGACTCTCTACCCTCCCCTTTCTGGGTTGACAGGTAGGTGAAGGTATAGTCTTGATTTAACTATTTTTTCCTTGCATTTGGCGGGGATCTCGTCAATATCGGGGGCCATTAACTTCTTAACTACTATCTACAATTGTCGTCCCTTGGCTATAAAGGCGGAGCGAATTCCGTTGTATCCTTGGGCAGCAGTAGTGACAAGGGTTTTGTTGGTTGGGTCTATTCCTGTTTTGGCGGGGGCTTTAACAATGTTGCTGCTTGATCGGCATGTTAACAGGACGTTTTTTGACCCTGTTGGAGGGGGCGATCCTGTTTTATTCCAGCATTTATTTTGGTTTTTTGGGCACCCGGAGGTGTATATTTTGATTCTTCCCGGGTTTGGTGTTGTTTCTCATGTGATTATGTATTACGCGCATAAACGGGAGGTTTGGGGGCACTTAGGAATGGTGTATTCTATAGTTGTGATCGGGTTTTTAGGGTTTTTGGTGTGGGCGCACCACATGTTTACGGTTGGGTTGGATGCAGATACTCGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Limaria fragilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at Museum of Tropical Queensland and Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Limaria fragilis

Limaria fragilis, the fragile file clam, is a species of bivalve mollusc in the family Limidae. It is found in shallow waters in the Indian and Pacific Oceans and has the ability to swim.

Description[edit]

The fragile file clam has a pair of hinged, thin, asymmetric white valves and a red mantle with a fringe of long tapering pink and grey banded tentacles at its edge. Also around the margin of the mantle are a row of tiny eyespots that can detect light and shade, and may alert the animal to the approach of a predator.[2]

Distribution and habitat[edit]

The fragile file clam is widely distributed in the Indo-Pacific region. Its range includes the Philippines, the Marshall Islands, the Cook Islands, Western Australia, the Chagos Archipelago, Madagascar and the Red Sea.[1] It often conceals itself in crevices or under stones with just its tentacles protruding.[2]

Biology[edit]

The fragile file clam is a protandrous hermaphrodite. Juveniles start life as males and change sex to females as they grow. Fragile file clams have the ability to emit flashes of biolumiscent light, though why they do this is unclear.[2]

The fragile file clam can swim slowly and continuously for about 5 minutes at a time.[3] It does this by opening and closing its valves and expelling water in a stream from either side of the hinge, a form of jet propulsion. In an aquarium, the animal flits around knocking into other objects.[2] It uses its mantle tentacles in an oar-like fashion when swimming. Sometimes it sheds the longest tentacles and can still swim effectively without them, increasing the frequency of valve clapping to maintain speed.[4] The detached tentacles secrete a noxious substance and continue to writhe after they are severed which may distract aggressors.[5]

It was originally thought that the energy for swimming was supplied aerobically through respiration with little input from anaerobic glycolysis and arginine phosphate. Further study showed that this was not the case. There was a high level of arginine kinase and certain other enzymes in the adductor muscles which was indicative of the conversion of arginine phosphate for energy production. Up to 23% of the ATP used for energy transfer was supplied in this way while the animal was swimming.[3]

References[edit]

  1. ^ a b c Huber, Markus (2010). "Limaria fragilis (Gmelin, 1791)". World Register of Marine Species. Retrieved 2012-04-20. 
  2. ^ a b c d Limaria fragilis Saltcorner. Retrieved 2012-04-20.
  3. ^ a b Baldwin, J.; Morris, G. M. (1983). "Re-examination of the contributions of aerobic and anaerobic energy production during swimming in the Bivalve mollusc Limaria fragilis (Family Limidae)". Australian Journal of Marine and Freshwater Research 34 (6): 909–914. doi:10.1071/MF9830909. 
  4. ^ Fleming, P. A.; Bateman, P. W. (2007). "Just drop it and run: the effect of limb autotomy on running distance and locomotion energetics of field crickets (Gryllus bimaculatus)". Journal of Experimental Biology 210 (8): 1446–1454. doi:10.1242/jeb.02757. 
  5. ^ Fleming, P. A.; Muller, D.; Bateman, P. W. (2007). "Leave it all behind: a taxonomic perspective of autotomy in invertebrates". Biological Reviews 82 (3): 481–510. doi:10.1111/j.1469-185X.2007.00020.x. PMID 17624964. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!