Ecology

Associations

Foodplant / open feeder
caterpillar of Bupalus piniaria grazes on live leaf of Pinus
Remarks: season: 6-9
Other: major host/prey

Foodplant / open feeder
caterpillar of Bupalus piniaria grazes on live leaf of Pinopsida
Remarks: season: 6-9

Animal / parasitoid / endoparasitoid
larva of Senometopia pollinosa is endoparasitoid of larva of Bupalus piniaria

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bupalus piniaria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGTATTTGAGCCGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGTAACCCAGGATCATTAATTAGAAATGACCAAATTTATAATACCATTGTAACCGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCCGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGATTACTACCCCCATCTATTACCCTTTTAATTTCAAGAAGAATTGTAGAAAACGGAGCTGGAACTGGTTGAACAGTATATCCTCCTTTATCCTCTAATATCGCTCATGGAGGAAGCTCAGTAGATTTAGCAATTTTTTCATTACATTTAGCTGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGATTAAATAATTTATCATTTGATCAAATACCACTATTTATTTGAGCTGTTGGAATTACTGCATTTTTATTATTACTATCTTTACCAGTATTAGCGGGAGCTATTACAATATTATTAACTGACCGAAATTTAAACACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bupalus piniaria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bordered White

The Bordered White (Bupalus piniaria), also known as the Pine Looper, is a moth of the geometer moth family (Geometridae). Among these, it belongs to tribe Bupalini of the subfamily Ennominae. B. piniaria is a common species throughout the western Palearctic region, the Near East and North Africa. However, its presence in certain regions – e.g. the northern Balkans – is doubtful.[1]

It is (under its original scientific name Phalaena piniaria) the type species of its genus Bupalus, as well as the junior objective synonyms Catograpta, Chleuastes and Phaophyga, and the preoccupied Bupala. Via its genus, it is also the type of the Bupalini.[2]

Three subspecies are generally recognized, while two additional ones are doubtfully distinct:[3]

In addition, some forms (e.g. kolleri) have also been named.[4]

Description and ecology

This moth is an inhabitant of coniferous woodland. The adults fly in May and June[verification needed], sometimes later (up to August or so) in the north of the range. Their wingspan is 34–40 mm. This is a variable species with strong sexual dimorphism, always conspicuous in the antennae which are combed in the males and plain in the females. Females, particularly when filled with ripe eggs, also have a plumper abdomen.[5]

The male has upperwings with broad dark brown borders and spots and a background varying from white in the north to deep yellow in southern populations. The female is plainer, varying from yellow to brown on the upperwings, which have slightly darker crosswise stripes. In both sexes, the wingtips are darkest. The underwings are less dimorphic, orange-brown with darker tips on the forewings and marbled light brown with a whitish lengthwise stripe on the hindwings in both sexes. The male's underwings have a wider whitish hindwing stripe and darker forewing tips, while the females have a more contrasting hindwing pattern. All four wings are bordered by a short fringe of alternating sections of white and dark brown hairs. Bilateral gynandromorphs are easily recognized in this species.[6]

The caterpillar larva is green with pale lines and usually feeds on various species of pine (Pinus), especially Scots Pine (P. sylvestris) and European Black Pine (P. nigra). It has also been recorded feeding on Douglas-fir (Pseudotsuga), larch (Larix) and spruce (Picea, e.g. Norway Spruce P. abies). This species overwinters as a pupa. It can be a serious pest in conifer plantations.[7]

Footnotes

  1. ^ Skinner (1984), Chinery (2007): 180, FE (2009)
  2. ^ Pitkin & Jenkins (2004)
  3. ^ FE (2009)
  4. ^ Reissner (1942)
  5. ^ Skinner (1984), Chinery (2007): 180-181
  6. ^ Reissner (1942), Skinner (1984), Chinery (2007): 180-181
  7. ^ Skinner (1984), Chinery (2007): 180, and see references in Savela (2001)

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!