Overview
Distribution
Red Sea
-
Fishelson, L., 1971. Ecology and distribution of the benthic fauna in the shallow waters of the Red Sea. Marine Biology, 10/2: 113-133.
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=29127
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Ecology
Habitat
Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 0 - 8
Temperature range (°C): 25.420 - 25.622
Nitrate (umol/L): 0.184 - 0.232
Salinity (PPS): 35.069 - 35.073
Oxygen (ml/l): 4.663 - 4.696
Phosphate (umol/l): 0.172 - 0.187
Silicate (umol/l): 3.620 - 4.026
Graphical representation
Depth range (m): 0 - 8
Temperature range (°C): 25.420 - 25.622
Nitrate (umol/L): 0.184 - 0.232
Salinity (PPS): 35.069 - 35.073
Oxygen (ml/l): 4.663 - 4.696
Phosphate (umol/l): 0.172 - 0.187
Silicate (umol/l): 3.620 - 4.026
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 3 samples.
Environmental ranges
Depth range (m): 0 - 8
Temperature range (°C): 25.420 - 25.622
Nitrate (umol/L): 0.184 - 0.232
Salinity (PPS): 35.069 - 35.073
Oxygen (ml/l): 4.663 - 4.696
Phosphate (umol/l): 0.172 - 0.187
Silicate (umol/l): 3.620 - 4.026
Graphical representation
Depth range (m): 0 - 8
Temperature range (°C): 25.420 - 25.622
Nitrate (umol/L): 0.184 - 0.232
Salinity (PPS): 35.069 - 35.073
Oxygen (ml/l): 4.663 - 4.696
Phosphate (umol/l): 0.172 - 0.187
Silicate (umol/l): 3.620 - 4.026
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Modiolus metcalfei
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
TTGCTTCCTCTAATGATAGGGTCAGTAGATATGATTTTTCCTCGTCTTAACAACTTAAGATTCTGGTTCTTACCCTCTTCTCTTTTTATGTTGCTAAGTTCTACGTTTATTGAAAGAGGGTCTGGTACCGGGTGGACACTTTATCCGCCTCTTTCTTCTTACACAGGACATAGGGGGCCAGCGGTTGATATGTCTTTGTTTTCTCTTCATCTGGCGGGTGCTTCTTCTATTGGAGGTTCAATCAACTTTCTTACCAGGATGAAAAATATGCCAGTTAAGCCGATGCAAGGGGAACGAATGATGTTATTCTTATGGTCTATGGTGGTTACTGCTGTCCTTCTTTTGGTTTCTTTACCTGTCTTGGCTGGTGGAATTACTATATTAATTTTTGATCGACATTTTAATACTTCGTTCTACGACCCAATGGGTGGAGGGGATCCAGTTTTATACCAACATTTGTTTTGGTTTTTTGGTCATCCGGAAGTCTATGTCCTTATTCTGCCGGGGTTTGGGATAGTTTCTCATGTTGTTGCTCACTGTGCAGGAAAGGATGAAGTATTTGGTGTTCTTGGTATAATCTATGCAATAGTTTGCATTGGGGTTTTGGGATTTATTGTTTGAGGTCATCACATGTTTACTGTAGGAATGGATGTGGATTCACGTG
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Modiolus metcalfei
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
