Overview

Distribution

Distribution: tropical, Indo-west Pacific Ocean, depth range 0-20 m. (Rowe & Gates, 1995); widespread indo-West Pacific (Massin, 1999). Also distributed in Australia (Rowe & Gates, 1995). Ecology: benthic, inshore, detritus feeder, deposit feeder (Rowe & Gates, 1995).
  • Massin, C. (1999). Reef-dwelling Holothuroidea (Echinodermata) of the Spermonde Archipelago (South-West Sulawesi, Indonesia). Zoologische Verhandelingen 329, Leiden. 144 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is widespread throughout the Indo Pacific and Red Sea, including Mozambique and Kenya to Australia and Indonesia (Samyn 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

In the Western Central Pacific region, this species prefers seagrass beds, rubble and sandy-muddy bottoms between 0 and 25 m (Kinch et al. 2008). In Africa and the Indian Ocean region, it can be found in lagoons, seagrass beds and rubble over sandy-muddy bottoms between 0 and 5 m (Conand 2008).

In the Great Barrier Reef (Australia), this species has a single reproductive event in November, and in New Caledonia it occurs in February (Kinch et al. 2008). In the Pacific, it reproduces during the warm season, and in the Islamic Republic of Iran it also reproduces during summer. This species reaches first maturity at 310 mm (Conand 2008).

Juveniles settle in reef flat zones and later migrate to other zones (Kinch et al. 2008). This species is host to the pearlfish Carapus mourlani and C. homei (Eeckhaut et al. 2004).

Generation length is unknown for this species. Body size is not a good indicator of age or longevity. There is some indication, however, that many echinoderms do not go through senescence, but simply regenerate. Therefore generation length cannot be estimated, but is assumed to be greater than several decades in a natural, undisturbed environment.


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 1.5 - 1.5
  Temperature range (°C): 24.146 - 24.146
  Nitrate (umol/L): 0.166 - 0.166
  Salinity (PPS): 35.418 - 35.418
  Oxygen (ml/l): 4.889 - 4.889
  Phosphate (umol/l): 0.142 - 0.142
  Silicate (umol/l): 1.345 - 1.345
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 4.5 - 30
  Temperature range (°C): 26.525 - 26.525
  Nitrate (umol/L): 0.732 - 0.732
  Salinity (PPS): 35.095 - 35.095
  Oxygen (ml/l): 4.572 - 4.572
  Phosphate (umol/l): 0.121 - 0.121
  Silicate (umol/l): 0.869 - 0.869

Graphical representation

Depth range (m): 4.5 - 30
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Stichopus herrmanni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTTTGGAAATTGACTAATACCATTAATGATAGGAGCCCCTGATATGGCATTCCCACGAATGAATAAAATGAGCTTCTGGTTAGTCCCCCCTTCTTTTATTCTTCTTTTAGCCTCAGCAGGAGTTGAAAGAGGTGTTGGAACTGGTTGAACAATTTATCCGCCGCTCTCGAGAAATATTGCCCATGCCGGGGGATCAGTGGATTTAGCCATTTTTTCCTTGCATTTAGCCGGAGCATCTTCCATACTTGCTTCAATTAACTTTATCACTACAATAATAAAAATGCGAACACCGGGGGTTACTTTTGACCGACTTCCCTTATTTGTTTGATCAGTTTTTATAACAGCATTTCTTCTCCTTCTCAGACTCCCAGTCCTAGCAGGAGCTATAACTATGCTTCTCACAGACCGAAAAATAAAAACTACCTTTTTTGACCCTGCTGGAGGGGGTGACCCAATTTTATTTCAACATCTTTTCTGATTTTTTGGACACCCAGAAGTCTACATCCTCATTCTTCCAGGGTTTGGAATGATTTCTCACGTAATAGCTCACTATAGAGGAAAGCAAGAACCTTTTGGATACCTAGGAATGGTTTACGCCATGGTAGCCATCGGAATTCTAGGTTTTCTAGTTTGAGCCCACCATATGTTTACAGTAGGGATGGACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Stichopus herrmanni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Stichopus hermanni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGAATAAAATGAGCTTCTGGTTAGTCCCCCCTTCTTTTATTCTTCTTTTAGCCTCAGCAGGAGTTGAAAGAGGTGTTGGAACTGGTTGAACAATTTATCCGCCGCTCTCTAGAAATATTGCCCATGCCGGGGGATCAGTGGATTTA---GCCATTTTTTCCTTGCATTTAGCCGGAGCATCTTCCATACTTGCTTCAATTAACTTTATCACTACAATAATAAAAATGCGAACACCGGGGGTTACTTTTGACCGACTTCCCTTATTTGTTTGATCAGTTTTTATAACAGCATTTCTTCTCCTTCTCAGACTCCCAGTCCTAGCAGGA---GCTATAACTATGCTTCTCACAGACCGAAAAATAAAAACTACCTTTTTTGACCCTGCTGGAGGGGGTGACCCAATTTTATTTCAACATCTTTTCTGATTTTTTGGACACCCAGAAGTCTACATCCTCATTCTTCCAGGGTTTGGAATGATTTCTCACGTAATAGCTCACTATAGAGGAAAGCAA---GAACCTTTTGGATACCTAGGAATGGTTTACGCCATGGTAGCCATCGGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Stichopus hermanni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at Museum of Tropical Queensland and Museum Victoria
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bd

Version
3.1

Year Assessed
2013

Assessor/s
Conand, C., Purcell, S. & Gamboa, R.

Reviewer/s
Polidoro, B., Knapp, L., Harwell, H. & Carpenter, K.E.

Contributor/s

Justification
This species is commercially exploited throughout its range, and is a medium value species that is somewhat difficult to process. Based on a number of quantitative and qualitative studies, populations are estimated to be depleted and have declined by more than 60-90% in at least 50% of its range, as there is some refuge in deeper waters, and is considered over exploited in at least 40% of it range although exact declines are difficult to estimate. The status of populations in Australia are considered stable, as it is not collected here. Declines and over-exploitation have occurred primarily since the 1960s, and although generation length is not known, echinoderms are not considered to go through senescence and therefore may be greater than several decades. At present, global declines are therefore estimated to be between 30-40% based on estimates of depletion and over exploitation across its range. This species is therefore listed as Vulnerable. However, better and more quantitative data are need to better estimate the impact of fishing on this species. If other shallow water species continue to be fished out, effort for this species will probably increase even further. Given this species' comparatively low fecundity, it is considered to be particularly susceptible to fishing pressure.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

This species has been heavily depleted in South East Asia and parts of the South Pacific (India, Viet Nam, Madagascar, Philippines, Indonesia, Papua New, New Caledonia, (approximately 50% of the range). The status of the populations in East Africa is unknown but assumed to be over-exploited (40% of its range). Populations in Australia (10% of range) are mostly unknown, and not yet targeted. Depletion refers to commercially unviable, and estimated to represent an approximately 60-90% loss or greater. Shallow waters are more heavily impacted. In areas where it is considered over-exploited, population is difficult to estimated based on variation in regional and local fishing effort, but harvests have declined and based traditional fisheries definitions, over-exploited is estimated to be 30% above maximum sustainable yield.

In Pohnpei (Federal States of Micronesia), relatively high population densities have been observed. In the Marshall Islands and Solomon Islands, it is considered scarce. In New Caledonia, some dense patches (100 ind*ha-1) have been found (Kinch et al. 2008). Purcell et al. (2009) recorded this species at 19 lagoon sites, evenly dispersed along la Grande Terre, New Caledonia. At four of those sites, abundances were between 1,000 and 4,000 ind*km-2. From 1992 to 2006 in New Ireland, Papua New Guinea estimates dropped more than 90% from 31 individuals to 0.3 individuals per hectare (Kaly et al. 2007). In the southeastern region of Papua New Guinea, catches of this species declined from 1200 kg dry weight in 2003 to 360 kg in 2004 (Skewes 2004).

In Viet Nam, this species was once highly abundant and is now believed to be approaching local extinction with less than 10 kg*day-1 caught at present, in comparison to 1 tonne*day-1 (Choo 2008). This species is close to extinction in Malaysia (Toral-Grande 2006, Choo 2004). In Indonesia, stocks of this species are depleted, as individuals are now collected at a small size (Choo et al. 2008). In the Philippines this species is heavily exploited due to its high value. The fishery for this species is closed in India due to overfishing.

In Madagascar this species is heavily exploited. Mean densities range from 4 to 50 individuals*ha-1 in Madagascar (Rasolofonirina pers comm. 2010). The status of this species in Australia and the Red Sea are unknown. It not currently fished in the Great Barrier Reef, but there is increasing interest to commercialize this species (Purcell pers. comm. 2010). In East Africa, little is known about the status of this species, but it is assumed that it is heavily collected as other large sea cucumbers (Conand pers comm. 2010). Kalaeb et al. (2008) used transect data to calculate a population density of 3.0 individuals of this species per hectare in near shore waters of Eritrea, East Africa. It is not collected in the Seychelles, as other higher value species are collected.


Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

This species has a medium commercial interest, is targeted throughout its range, and fishing pressure has dramatically increased in the past 25 to 50 years, since the 1960s, and is expected to continue, even as stocks are depleted. When this occurs, other species are often targeted in their place. There is an illegal fishery for this species in India (Conand 2008).

Although not one of the most important species (low value) for fishery purposes, it can be expected that this species may become more popular after the depletion or reduction of other species of higher commercial importance and value. This species is being increasingly collected as stocks of other species decline, such as in Papua New Guinea and the Philippines.



Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

In Papua New Guinea, there is a minimum size of 25 cm TL live and 10 cm TL dry. In New Caledonia, there is a minimum size of 35 cm TL live and 15 cm TL dry, and in Torres Strait (Australia) of 27 cm TL live (Kinch et al. 2008).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!