Overview

Distribution

Range Description

This species occurs throughout the Indo-Pacific, from eastern Africa (Mozambique and Madagascar and north) and the Arabian Peninsula (including the Red Sea), to India and the Southeast Asian peninsula, throughout the Indo-Malay Philippine Archipelago, south to northern Australia, north to coastal China, and east throughout Micronesia and the Marshall Islands, to Kiribati and French Polynesia.

This species is distributed from East Africa, and Southeast Arabia, widespread throughout the Indo-West pacific, from North Australia to Japan and south Pacific Islands, and in the East Indies.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

Also distributed in Ostasiatische Meere (Selenka, 1867); SE Arabia, Maldive area, Ceylon, Bay of Bengal, East Indies, north Australia, Philippine, China, south Japan and South Pacific Is. (Clark & Rowe, 1971); Australia (Rowe & Gates, 1995); India (Sastry, 1996). General distribution: tropical, Indo-west Pacific Ocean, depth range 0-20 m.(Rowe & Gates, 1995); widespread in the tropical Indo-Pacific (Conand, 1998). Ecology: benthic, inshore, detritus feeder, deposit feeder (Rowe & Gates, 1995). Habitat: shallow water; inner and outer flats of coastal reefs, back reefs or shallow coastal lagoons, barrier reefs, sandy-muddy ground with rubble or coral patches and in seagrass beds (Conand, 1998).
  • Cherbonnier, G. (1988). Echinodermes: Holothurides. Faune de Madagascar 70: 1-292.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
A common shallow water species, this species mostly inhabits inner and outer flats of coastal reefs, back reefs, or shallow coastal lagoons, and can be found as deep as 45 m. Specimens from barrier reefs have been reported to have a brown bivium and whitish trivium. It is most abundant on sandy-muddy grounds with rubble or coral patches and in seagrass beds.

In the Western Central Pacific, this species lives in inner reef flats or fringing and lagoon-islet reefs, and shallow coastal lagoons between 0 and 30 m (Kinch et al. 2008). In the Asia region, it feeds actively during the day and rests at irregular intervals (Choo 2008). In Africa and the Indian Ocean region, this species lives in seagrass and lagoons over sandy substrate between 0 and 30 m. In Madagascar, it inhabits the inner slope, the seagrass meadows and the microatoll, with highest density (0.612 kg*ha-1) in the inner slope (Conand 2008).

In the Great Barrier Reef, this species reproduces between December and January (Kinch et al. 2008).

No information is known on changes of habitat requirements during the life history of the species, but generally, the juveniles of aspidochirotids are cryptic and small individuals that may migrate into adult habitat later (Purcell 2004).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 124 specimens in 1 taxon.
Water temperature and chemistry ranges based on 112 samples.

Environmental ranges
  Depth range (m): 2.5 - 83.5
  Temperature range (°C): 23.278 - 28.764
  Nitrate (umol/L): 0.052 - 15.217
  Salinity (PPS): 33.721 - 36.837
  Oxygen (ml/l): 2.605 - 4.838
  Phosphate (umol/l): 0.055 - 0.976
  Silicate (umol/l): 1.005 - 17.255

Graphical representation

Depth range (m): 2.5 - 83.5

Temperature range (°C): 23.278 - 28.764

Nitrate (umol/L): 0.052 - 15.217

Salinity (PPS): 33.721 - 36.837

Oxygen (ml/l): 2.605 - 4.838

Phosphate (umol/l): 0.055 - 0.976

Silicate (umol/l): 1.005 - 17.255
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Holothuria edulis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TAATGATAGGAGGGTTTGGAAAATGACTTATACCCTTAATGATAGGAGCCCCAGACATGGCCTTCCCCCGAATGAAAAACATGAGATTTTGACTAGTCCCTCCTTCTTTTATTTTACTTCTAGCCTCAGCAGGAGTAGAAAGAGGAGTGGGTACAGGATGAACCATTTATCCCCCACTATCAAGAAAAATCGCCCACGCTGGAGGATCAGTCGACCTAGCAATATTCTCCCTACACCTAGCCGGAGCTTCTTCAATACTAGCCTCAATAAAATTCATAACAACAATCATAAAAATGCGAACCCCAGGAGTCACTTTTGACCGGCTACCACTATTCGTGTGGTCTGTCTTCATAACGGCATTTCTTCTTCTACTTAGACTACCTGTCCTAGCAGGGGCAATCACAATGCTTTTAACTGACCGAAACATCAAAACAACTTTCTTCGACCCAGCCGGAGGAGGAGACCCCATCTTATTTCAACATCTCTTCTGATTCTTTGGCCACCCAGAAGTATACATTCTTATTCTACCCGGTTTCGGAATGATATCCCACGTAATCGCCCACTACAGAGGCAAGCAAGAACCCTTTGGCTACTTAGGAATGGTATACGCAATGGTCGCAATAGGAATCCTAGGGTTTCTAGTATGAGCCCACCATATGTTCACCGTTGGCA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Holothuria edulis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at Florida Museum of Natural History and Raffles Museum, Singapore
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Conand, C., Purcell, S. & Gamboa, R.

Reviewer/s
Polidoro, B., Carpenter, K.E., Knapp, L. & Harwell, H.

Contributor/s

Justification

This species is widespread in the Indo-Pacific, and can be common in some parts of its range. It occurs in shallow waters. It is widely fished, but has low commercial value and there is no current indication of widespread population decline. It is listed as Least Concern.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species can be common.

Kalaeb et al. (2008) used transect data to calculate a population density of 48.5 individuals of this species per hectare in near shore waters of Eritrea, east Africa.

During surveys, Purcell et al. (2009) found this species at 28% of sites, and it was found more frequently in reef passes and in deeper lagoon areas and places on the reef slope with sand or rubble. It was rarely very abundant but moderate abundances above 1,000 ind*km-2 were estimated at 6 sites.

In Seychelles, it has a density of 0.35 ind*ha-1 (Aumeeruddy and Conand, 2008).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Although not one of the most important species (low value) for fishery purposes, it can be expected that this species may become more popular after the depletion or reduction of other species of higher commercial importance and value. This has been seen in Viet Nam, after the decline of Holothuria scabra (Choo 2008).

Many sea cucumbers are broadcast spawners, which can limit the fertilization success of a species in exploited populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

This species may be present in some marine protected areas within its range. In PNG, it has a minimum live size of 25 cm TL and 10 cm TL dry (Kinch et al. 2008) and a compulsory closed season between October 1st and January 15th or when TAC is reached. TAC is province specific (Bruckner 2005).

With the inclusion of Isostichopus fuscus in CITES Appendix III, a debate started whether the conservation of this group may be addressed with their inclusion in one of CITES appendices. The debate started in Conference of the Parties (CoP) 12 (Santiago, Chile) and extended to CoP 14 (The Hague, Netherlands). No recent advances have been achieved on this matter. For a revision of the possible pros and cons of a CITES listing, please see Toral-Granda (2007).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Holothuria edulis

Holothuria edulis, commonly known as the edible sea cucumber or the pink and black sea cucumber, is a species of echinoderm in the family Holothuriidae. It was placed in the subgenus Halodeima by Pearson in 1914, making its full scientific name Holothuria (Halodeima) edulis.[1] It is found in shallow water in the temperate and tropical western part of the Indo-Pacific Ocean.

Contents

Description

Holothuria edulis is a medium-sized sea cucumber reaching a length of about 30 centimetres (12 in). It has a roughly cylindrical shape with rounded ends but can retract and expand its body and adopt different shapes. It is usually soft and pliable with a smooth skin but, due to the special characteristics of its connective tissue, it can become firm and rigid. The body is lined with longitudinal rows of small tube feet which can be withdrawn into the body wall, leaving small hollows. About twenty tube feet in a ring round the mouth are modified into feeding tentacles. This sea cucumber is usually a dark reddish-black colour on its upper side and a pinkish-mauve colour below, but can be grey or dark brown.[2][3][4]

Distribution and habitat

Grey form from Japan

Holothuria edulis is a common and widespread species in the western Indo-Pacific Ocean. It lives on the seabed at depths down to 20 metres (66 ft). Its range extends from the Red Sea and East African coast to Sri Lanka, Japan, China, Indonesia, the Philippines and northern Australia. It is found in a number of different habitats including on sandy or muddy substrates, on coral rubble and in seagrass meadows. It can be found on inner and outer reef flats, on back reef slopes and in lagoons.[1]

Biology

Holothuria edulis is mainly nocturnal and tends to hide during the day under rocks or pieces of coral. It is a detritivore and feeds by ingesting sand and debris which has accumulated on the seabed which it picks up using its feeding tentacles. Sand is pushed into the mouth and any organic matter present, including the biofilm round the grains, is digested as the sand passes through the gut. The indigestible matter is expelled from the anus leaving a sand ridge as the animal moves around. During its feeding activities, the sea cucumber churns up the top few centimetres of seabed and aerates the sediment.[3]

Locomotion in Holothuria edulis is very slow. It moves mainly by peristaltic action of its body wall, assisted to a limited extent by its tube feet. It can also anchor its feeding tentacles into the sand and haul itself along. If it gets overturned, it can use its feeding tentacles to help right itself.[3]

Holothuria edulis has separate sexes and spawns at any time of year with gametes being liberated into the water column. The larvae are planktonic. This sea cucumber can also reproduce asexually by breaking into two parts, each of which then regrows the missing organs.[3]

Uses

As its name implies, Holothuria edulis is edible and is dried and sold as "bêche-de-mer" or "trepang" in China and Indonesia.[5]

References

  1. ^ a b c d Paulay, Gustav (2010). "Holothuria (Halodeima) edulis Lesson, 1830". World Register of Marine Species. Retrieved 2013-03-26. 
  2. ^ "Holothuria edulis". North Australian Sea Cucumbers. Marine Species Identification Portal. Retrieved 2013-03-26. 
  3. ^ a b c d Turschwell, Mischa (2011). "Holothuria edulis: Edible sea cucumber". Great Barrier Reef Invertebrates. University of Queensland. Retrieved 2013-03-27. 
  4. ^ Rudman, W. B. (1998). "Sea cucumbers". Sea Slug Forum. Australian Museum. Retrieved 2013-03-27. 
  5. ^ "Bêche-de-Mer". 1911 Encyclopædia Britannica. Retrieved 2013-03-27. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!