Overview

Distribution

Widespread in the tropical Indo-Pacific, excluding the Persian Gulf and Hawaii (Conand, 1998).
  • Massin, C. (1999). Reef-dwelling Holothuroidea (Echinodermata) of the Spermonde Archipelago (South-West Sulawesi, Indonesia). Zoologische Verhandelingen 329, Leiden. 144 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is found in the Indo-Pacific, excluding the Persian Gulf and Hawaii. It occurs from eastern Africa (Kenya) to Kiribati and the Marshall Islands in the east. The range includes northern Australia in the south, and the Red Sea to the Philippines (including India, Bangladesh and the southeast Asian peninsula) in the north.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

This is a coral reef species rarely found in depths of more than 25 m; mostly found on reef slopes close to the coast; abundant on corals mixed with calcareous red algae. In the Western Central Pacific region, this species can be found in reef slopes and protected back reef areas in patch reef close to the coast between 0 and 25 m (Kinch et al. 2008). In Africa and the Indian Ocean region, this species prefers to inhabit living corals in shallow reefs. It often feeds during the day and night on detritus. In Kenya, this species is often found grazing on dead coral and sponges (Samyn 2000). This species does not burrow. Little is known on its biology (Conand 2008). In Japan, it lives in sandy areas and reef zones between 5 and 20 m (Bruckner 2005).

In the Great Barrier Reef (Australia), this species reproduces between November and February (Kinch et al. 2008). The juveniles of this species are very different from the adult, resembling toxic nudibranchs (Samyn et al. 2006, Conand 2008). This species is known to host the pearl fish Carapus boraborensis (Eeckhaut et al. 2004).

There are quite a few observations of spawning of this species (Conand pers. comm. 2010).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 138 specimens in 1 taxon.
Water temperature and chemistry ranges based on 133 samples.

Environmental ranges
  Depth range (m): 1 - 14
  Temperature range (°C): 27.628 - 28.792
  Nitrate (umol/L): 0.033 - 0.523
  Salinity (PPS): 34.077 - 34.987
  Oxygen (ml/l): 4.436 - 4.643
  Phosphate (umol/l): 0.067 - 0.238
  Silicate (umol/l): 1.110 - 4.958

Graphical representation

Depth range (m): 1 - 14

Temperature range (°C): 27.628 - 28.792

Nitrate (umol/L): 0.033 - 0.523

Salinity (PPS): 34.077 - 34.987

Oxygen (ml/l): 4.436 - 4.643

Phosphate (umol/l): 0.067 - 0.238

Silicate (umol/l): 1.110 - 4.958
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pearsonothuria graeffei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTGGAAAATGACTTATCCCATTAATGATAGGAGCCCCTGATATGGCCTTTCCACGAATGAAAAACATGAGCTTTTGACTTGTTCCTCCTTCCTTTATTCTTCTACTAGCCTCCGCTGGAGTAGAGAGAGGAGTAGGAACTGGATGGACTATATACCCTCCGCTCTCCAGAAAAATAGCTCACGCAGGGGGATCAGTAGACCTAGCAATCTTTTCTCTCCACTTAGCAGGAGCCTCCTCCATTTTAGCATCAATAAACTTTATAACAACCATAATAAAAATGCGTACCCCAGGTATAACTTTTGATCGCTTACCTCTATTTGTGTGATCCGTATTTATAACGGCATTTCTTCTTCTTCTTAGACTTCCAGTATTAGCTGGAGCCATCACTATGCTACTAACAGATCGTAACATAAAAACGACGTTCTTTGACCCAGCAGGAGGAGGGGACCCAATTTTATTTCAACACTTATTCTGATTCTTTGGCCACCCAGAAGTTTATATTCTTATTTTACCAGGATTTGGAATGATATCTCACGTAATTGCTCACTACAGTGGAAAGCAAGAACCCTTTGGTTACCTAGGAATGGTTTACGCGATGGTAGCTATAGGAATCTTAGGATTCTTAGTTTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pearsonothuria graeffei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Conand, C., Gamboa, R. & Purcell, S.

Reviewer/s
Polidoro, B., Knapp, L., Carpenter, K.E. & Harwell, H.

Contributor/s

Justification
This species is widespread in the Indo-Pacific, and is considered common. It is heavily fished in at least 25% of its range (Philippines, Indonesia, Malaysia and Madagascar), however due to its low commercial value, it is not readily fished in the other parts of its range. It is listed as Least Concern. However, this species should be monitored, if it becomes of higher value or as other high value species become depleted.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This is a very common species. Population densities are generally less than 50 individuals per hectare. In Seychelles, it has an average density of 0.08 ind*ha-1 where it is unexploited (Aumeeruddy and Conand 2008). In Papua New Guinea, there were 4 ind*/ha-1 in 1992 and 6 ind*ha-1 in 2006 (Kaly et al. 2007)

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats

This species is harvested in part of its range. However, the affect of this action on the population of this species is unknown. There are no other known threats occurring to this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species specific conservation measures for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pearsonothuria

Pearsonothuria is a genus of sea cucumbers in the family Holothuriidae. Pearsonothuria graeffei is the only species in the genus.[1] Graeffe's sea cucumber is found in the tropical Indo-Pacific Ocean and the type locality is Viti Island, Fiji.[2]

Description[edit]

Pearsonothuria graeffei is a roughly cylindrical, thin-walled sea cucumber that grows to about 30 centimetres (12 in) in length.[3] Its mouth, at one end, is surrounded by a ring of up to 24 leaf-like, paddle-shaped tentacles with black stalks which are black on the upper side and white beneath. The anus is at the other end of the body and there are several rows of tube feet along the underside. The colour of the adults is pale brown and white, with black speckles and small thorn-like protuberances.

A live juvenile individual of Pearsonothuria graeffei, in situ off Madagascar

By contrast, the juveniles are brightly coloured, being white and blue or black, with a few large, yellow, thorn-like projections. This colouration makes them closely resemble the sea slug, Phyllidia varicosa, the bright colours of which warn predators of its toxicity. The appearance of the juvenile sea cucumbers begins to change when they grow larger than the slug and the mimicry is no longer effective.[4]

Distribution[edit]

Pearsonothuria graeffei is found in tropical parts of the Indo-Pacific Ocean. The range extends from the east coast of Africa to the Philippines and Indonesia. It is found on the seabed and on coral reefs at depths down to about 25 metres (82 ft).[2][3]

Biology[edit]

Pearsonothuria graeffei is a scavenger and roams around on the seabed sifting through the sediment with its feeding tentacles. Any organic matter it finds is passed to its mouth by the tentacles.[5] Its daily activities start within a few minutes of dawn and continue until half an hour after sunset after which time it adopts an inactive stance with its rear end raised and its tentacles retracted into its mouth. It then remains immobile during the night.[6]

When threatened or disturbed, many sea cucumbers eject cuvierian tubules, thin white sticky strands of viscera, from their cloacas. Pearsonothuria graeffei seems reluctant to do this except under conditions of extreme stress. The threads of this species contain glycosides that are toxic to the aggressor. The effect of these neuro-toxins is to prevent nerve impulses being transmitted, an effect similar to that produced by cocaine. The chemicals, echinoside A and ds-echinoside A, are being investigated for their possible use by humans as painkillers or anti-tumour drugs.[4] Experiments in vitro show that they have marked anti-cancer activity in Hep G2 cells and that, when given to mice with H22 hepatocellular carcinoma tumours (liver cancer), the weight of the tumours was reduced by about 50%.[7]

References[edit]

  1. ^ a b Martinez, Olga (2006). "Pearsonothuria Levin in Levin, Kalinin & Stonik, 1984". World Register of Marine Species. Retrieved 2012-02-16. 
  2. ^ a b c Paulay, Gustav (2010). "Pearsonothuria graeffei (Semper, 1868)". World Register of Marine Species. Retrieved 2012-02-16. 
  3. ^ a b Graeffe's sea cucumber Tropical Reefs. Retrieved 2012-02-16.
  4. ^ a b Invertebrate of the month: Pearsonothuria graeffei Florida Museum of Natural History. Retrieved 2012-02-16.
  5. ^ Pearsonothuria graeffei Wildwatch.com. Retrieved 2012-02-16.
  6. ^ Behavioral Effects of Light on the Tropical Holothurian Pearsonothuria graeffei Society for Integrative and Behavioral Biology. Retrieved 2012-02-16.
  7. ^ Qin Zhao et al. (2011). "In vitro and in vivo anti-tumour activities of echinoside A and ds-echinoside A from Pearsonothuria graeffei". Journal of the Science of Food and Agriculture 92 (4): 965–974. doi:10.1002/jsfa.4678. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!