Overview

Distribution

Comores, Kenyan Exclusive Economic Zone, Madagascar, Red Sea
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Widespread in the tropical Indo-Pacific, excluding the Persian Gulf and Hawaii (Conand, 1998).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 138 specimens in 1 taxon.
Water temperature and chemistry ranges based on 133 samples.

Environmental ranges
  Depth range (m): 1 - 14
  Temperature range (°C): 27.628 - 28.792
  Nitrate (umol/L): 0.033 - 0.523
  Salinity (PPS): 34.077 - 34.987
  Oxygen (ml/l): 4.436 - 4.643
  Phosphate (umol/l): 0.067 - 0.238
  Silicate (umol/l): 1.110 - 4.958

Graphical representation

Depth range (m): 1 - 14

Temperature range (°C): 27.628 - 28.792

Nitrate (umol/L): 0.033 - 0.523

Salinity (PPS): 34.077 - 34.987

Oxygen (ml/l): 4.436 - 4.643

Phosphate (umol/l): 0.067 - 0.238

Silicate (umol/l): 1.110 - 4.958
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pearsonothuria graeffei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTGGAAAATGACTTATCCCATTAATGATAGGAGCCCCTGATATGGCCTTTCCACGAATGAAAAACATGAGCTTTTGACTTGTTCCTCCTTCCTTTATTCTTCTACTAGCCTCCGCTGGAGTAGAGAGAGGAGTAGGAACTGGATGGACTATATACCCTCCGCTCTCCAGAAAAATAGCTCACGCAGGGGGATCAGTAGACCTAGCAATCTTTTCTCTCCACTTAGCAGGAGCCTCCTCCATTTTAGCATCAATAAACTTTATAACAACCATAATAAAAATGCGTACCCCAGGTATAACTTTTGATCGCTTACCTCTATTTGTGTGATCCGTATTTATAACGGCATTTCTTCTTCTTCTTAGACTTCCAGTATTAGCTGGAGCCATCACTATGCTACTAACAGATCGTAACATAAAAACGACGTTCTTTGACCCAGCAGGAGGAGGGGACCCAATTTTATTTCAACACTTATTCTGATTCTTTGGCCACCCAGAAGTTTATATTCTTATTTTACCAGGATTTGGAATGATATCTCACGTAATTGCTCACTACAGTGGAAAGCAAGAACCCTTTGGTTACCTAGGAATGGTTTACGCGATGGTAGCTATAGGAATCTTAGGATTCTTAGTTTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pearsonothuria graeffei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pearsonothuria

Pearsonothuria is a genus of sea cucumbers in the family Holothuriidae. Pearsonothuria graeffei is the only species in the genus.[1] Graeffe's sea cucumber is found in the tropical Indo-Pacific Ocean and the type locality is Viti Island, Fiji.[2]

Contents

Description

Pearsonothuria graeffei is a roughly cylindrical, thin-walled sea cucumber that grows to about 30 centimetres (12 in) in length.[3] Its mouth, at one end, is surrounded by a ring of up to 24 leaf-like, paddle-shaped tentacles with black stalks which are black on the upper side and white beneath. The anus is at the other end of the body and there are several rows of tube feet along the underside. The colour of the adults is pale brown and white, with black speckles and small thorn-like protuberances.

A live juvenile individual of Pearsonothuria graeffei, in situ off Madagascar

By contrast, the juveniles are brightly coloured, being white and blue or black, with a few large, yellow, thorn-like projections. This colouration makes them closely resemble the sea slug, Phyllidia varicosa, the bright colours of which warn predators of its toxicity. The appearance of the juvenile sea cucumbers begins to change when they grow larger than the slug and the mimicry is no longer effective.[4]

Distribution

Pearsonothuria graeffei is found in tropical parts of the Indo-Pacific Ocean. The range extends from the east coast of Africa to the Philippines and Indonesia. It is found on the seabed and on coral reefs at depths down to about 25 metres (82 ft).[2][3]

Biology

Pearsonothuria graeffei is a scavenger and roams around on the seabed sifting through the sediment with its feeding tentacles. Any organic matter it finds is passed to its mouth by the tentacles.[5] Its daily activities start within a few minutes of dawn and continue until half an hour after sunset after which time it adopts an inactive stance with its rear end raised and its tentacles retracted into its mouth. It then remains immobile during the night.[6]

When threatened or disturbed, many sea cucumbers eject cuvierian tubules, thin white sticky strands of viscera, from their cloacas. Pearsonothuria graeffei seems reluctant to do this except under conditions of extreme stress. The threads of this species contain glycosides that are toxic to the aggressor. The effect of these neuro-toxins is to prevent nerve impulses being transmitted, an effect similar to that produced by cocaine. The chemicals, echinoside A and ds-echinoside A, are being investigated for their possible use by humans as painkillers or anti-tumour drugs.[4] Experiments in vitro show that they have marked anti-cancer activity in Hep G2 cells and that, when given to mice with H22 hepatocellular carcinoma tumours (liver cancer), the weight of the tumours was reduced by about 50%.[7]

References

  1. ^ a b Martinez, Olga (2006). "Pearsonothuria Levin in Levin, Kalinin & Stonik, 1984". World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=204297. Retrieved 2012-02-16.
  2. ^ a b c Paulay, Gustav (2010). "Pearsonothuria graeffei (Semper, 1868)". World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=210772. Retrieved 2012-02-16.
  3. ^ a b Graeffe's sea cucumber Tropical Reefs. Retrieved 2012-02-16.
  4. ^ a b Invertebrate of the month: Pearsonothuria graeffei Florida Museum of Natural History. Retrieved 2012-02-16.
  5. ^ Pearsonothuria graeffei Wildwatch.com. Retrieved 2012-02-16.
  6. ^ Behavioral Effects of Light on the Tropical Holothurian Pearsonothuria graeffei Society for Integrative and Behavioral Biology. Retrieved 2012-02-16.
  7. ^ Qin Zhao et al. (2011). "In vitro and in vivo anti-tumour activities of echinoside A and ds-echinoside A from Pearsonothuria graeffei". Journal of the Science of Food and Agriculture 92 (4): 965–974. doi:10.1002/jsfa.4678. http://onlinelibrary.wiley.com/doi/10.1002/jsfa.4678/abstract.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!