Overview

Distribution

Range Description

This species is found in the Indo-West Pacific, except the Hawaiian Islands (Bruckner 2005). It is also found in the Western Central Pacific (Kinch et al. 2008), certain countries in Asia (Choo 2008) and in the Western Indian Ocean (Conand 2008) regions.

It is found from east Africa (Mozambique, Kenya, Madagascar and the Red Sea) to India (including Andaman Islands), to Indonesia and the Philippines. It can be found as far north as southern China and Japan, and south to northern Australia and various South Pacific islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

Colour in life: well defined cream coloured sole with white longitudinal band about 1/6th width running longitudinally along ventral surface. Rest of surface cream background mostly obscured by bold charcoal-grey and brown blotches or speckles (Humphreys, 1981). Also distributed in Celebes (Selenka, 1867); Ceylon, Bay of Bengal, East Indies, north Australia, Philippine, China, south Japan and south Pacific Is. (Clark & Rowe, 1971); Australia (Rowe & Gates, 1995). Ecology: benthic, inshore, detritus feeder, deposit feeder. General distribution: tropical, Indo-west Pacific Ocean, depth range 0-36 m. (Rowe & Gates, 1995).
  • Cherbonnier, G. (1988). Echinodermes: Holothurides. Faune de Madagascar 70: 1-292.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

This species prefers habitats with strong currents (Purcell et al. 2008) near seagrass and coral reefs, typically in areas deeper than 10 m (Choo 2008). In the Western Indian Ocean and Africa, it prefers the back reef seagrass over sandy bottoms between 0 and 20 m (Conand 2008). In China, it prefers deep waters, between 40 and 60 m (Li 2004).

This species occurs in coarse coral sand, from the intertidal to a depth of 10 m. It is a burrowing form and comes out of the mud during cloudy days and at night. Small individuals are usually buried in the sand while larger specimens are covered with a thin layer of sand (Schoppe 2000).

No information is known on changes of habitat requirements during the life history of the species, but generally, the juveniles of aspidochirotids are cryptic and small individuals that may migrate into adult habitat later (Purcell 2004).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 37 specimens in 1 taxon.
Water temperature and chemistry ranges based on 16 samples.

Environmental ranges
  Depth range (m): 0.5 - 208
  Temperature range (°C): 24.169 - 28.764
  Nitrate (umol/L): 0.054 - 1.347
  Salinity (PPS): 33.032 - 35.470
  Oxygen (ml/l): 4.450 - 4.793
  Phosphate (umol/l): 0.055 - 0.177
  Silicate (umol/l): 0.873 - 2.460

Graphical representation

Depth range (m): 0.5 - 208

Temperature range (°C): 24.169 - 28.764

Nitrate (umol/L): 0.054 - 1.347

Salinity (PPS): 33.032 - 35.470

Oxygen (ml/l): 4.450 - 4.793

Phosphate (umol/l): 0.055 - 0.177

Silicate (umol/l): 0.873 - 2.460
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bohadschia marmorata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGCACAGCCCGGTCACTACTTCAAGAT---GACCAAATATATAAAGTTATAGTAACCGCCCACGCTTTAGTAATGATTTTCTTTATGGTAATGCCAATAATGATAGGGGGCTTTGGAAACTGGCTTATTCCCCTGATGATAGGAGCCCCTGACATGGCATTTCCCCGAATGAATAAAATGAGTTTTTGATTAGTCCCCCCTTCTTTCATTTTACTCTTAGCATCAGCAGGAGTAGAAAGGGGTGTTGGAACAGGATGAACAATCTATCCACCCTTATCTAGAAAAATAGCCCACGCTGGGGGGTCGGTAGACCTTGCCATCTTCTCTTTACATTTAGCGGGGGCTTCCTCCATACTAGCCTCCATAAAATTTATAACAACCATTATAAACATGCGAACTCCAGGGATAACTTTTGACCGTCTTCCGTTGTTCGTATGATCCGTATTCATAACTGCCTTTCTTCTCCTCCTGAGCCTGCCAGTACTGGCAGGCGCCATAACCATGCTCCTAACGGACCGAAACATAAAAACGACCTTCTTTGACCCAGCGGGAGGGGGAGACCCTATTTTATTTCAACATCTGTTCTGATTCTTCGGACATCCGGAAGTTTACATCCTCATTTTACCTGGATTCGGAATGATATCCCACGTTATCGCTCACTACAGAGGCAAGCAAGAACCTTTCGGATATCTTGGTATGGTGTACGCCATGGTAGCCATAGGAATACTTGGATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bohadschia marmorata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Conand, C. & Purcell, S.

Reviewer/s
Polidoro, B., Carpenter, K.E., Knapp, L. & Harwell, H.

Contributor/s

Justification
The taxonomy for this species is unclear and needs to be revisited. The complex (Bohadschia similis, B. vitiensis, and B. marmorata) needs to be clarified and a synthesis is needed. Therefore this species is listed as Data Deficient.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In India, Holothuria scabra, H. spinifera and Bohadschia marmorata have been collected over the last 1000 years. Fishermen began collecting other species in 1990, in response to high export value and population declines. Actinopyga echinites and A. miliaris populations were overexploited in some areas as early as 2 years later (Bruckner et al. 2003).

In the Gulf of Manner and Pal Bay, CPUE and size of specimens has dramatically declined (Bruckner et al. 2003).

In the Maldives, export of Thelenota ananas, Holothuria nobilis, and Bohadschia marmorata increased from 3 t in 1986 (start of the fishery) to 740 t in 1990 (Bruckner et al. 2003).

In the Philippines, annual exports increased from 250 t in 1977 and 1189 t in 1984 to 2123 t in 1996 for 25 species including Holothuria scabra, H. nobilis, Bohadschia marmorata, H. fuscogilva, H. atra and Actinopyga lecanora (Bruckner et al. 2003).

In Thailand, populations of this species have decreased in fishing areas (Bruckner et al. 2003).

In the Seychelles, this species has been observed at population densities of 1.79 individuals ha-1 (Aumeeruddy and Conand 2008).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

This species is considered underexploited (Aumeeruddy 2007, Aumeeruddy and Conand 2008). In Tanzania, it is among the most important species despite its low value (Mgaya and Mmbaga 2007). In India, this species used to be fished as one of the most valuable commercial species. However, due to population decline, the government declared a fishing ban as of 2001 (Bruckner 2005).

Although not one of the most important species (low value) for fishery purposes, it can be expected that this species may become more popular after the depletion or reduction of other species of higher commercial importance and value. This was observed in Tanzania after the depletion of Holothuria scabra (Mgaya and Mmbaga, 2007).

This species is of low commercial value but is exploited in Torres Straight (Skewes 2004).

In India, Holothuria scabra, H. spinifera and Bohadschia marmorata have been collected over the last 1000 years. Fishermen began collecting other species in 1990, in response to high export value and population declines. Actinopyga echinites and A. miliaris populations were overexploited in some areas as early as 2 years later (Bruckner et al. 2003).

Many sea cucumbers are broadcast spawners, which can limit the fertilization success of a species in exploited populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Sea cucumber collection is restricted in some areas and has been banned in other areas including the Andaman and Nicobar Islands (Bruckner et al. 2003). A sea cucumber fishing ban is in place in India as of 2001 (Bruckner 2005). The distribution of this species directly overlaps with several marine protected areas.

With the inclusion of Isostichopus fuscus in CITES Appendix III, a debate started about whether the conservation of this group may be addressed with their inclusion in one of CITES appendices. The debate started in Conference of the Parties (CoP) 12 (Santiago, Chile) and extended to CoP 14 (The Hague, Netherlands). No recent advances have been achieved on this matter. For a revision of the possible pros and cons of a CITES listing, please see Toral-Granda (2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bohadschia marmorata

Bohadschia marmorata, commonly known as the brown sandfish, is a species of sea cucumber in the family Holothuriidae. It lives on the seabed in shallow waters in the Indo-Pacific region.

Description[edit]

Bohadschia marmorata is cylindrical in shape and grows to about 35 centimetres (14 in) long. The body wall is tough and leathery and has a rough texture due to the calcareous spicules it contains. It is covered in translucent papillae up to 1 centimetre (0.39 in) across and a few short spines. The anterior end of the body is somewhat narrowed and has a mouth surrounded by a ring of retractile tentacles. The posterior end is rounded and has an anal opening. Adjoining this is the cloaca through which defensive white sticky threads, the cuvierian tubes, may be ejected when the animal is stressed. The cloaca is also connected to the respiratory tree, into and out of which water is pumped for gas exchange. The body colour is cream or orange partially obscured by variable numbers of dark brown speckles and blotches. On the underside is a wide pale-coloured longitudinal stripe and many short, slender tube feet with knobbly tips.[2][3][4]

Distribution and habitat[edit]

Bohadschia marmorata is found in the Indo-Pacific Ocean. The range extends from the Red Sea and east coast of Africa to Japan, the Philippines and Australia.[1] It lives on the sandy or gravelly bottoms of shallow water areas and seagrass meadows at depths down to about 36 metres (118 ft). It is often semi-submerged in the sand.[1][4]

Biology[edit]

Bohadschia marmorata is a detritivore. It uses its tube feet to move around and scoops sand, mud and debris into its mouth with its oral tentacles. Having processed this material in its gut, it voids the remains, leaving a characteristic trail of sand on the seabed.[1][5]

References[edit]

  1. ^ a b c d Paulay, Gustav (2010). "Bohadschia marmorata Jaeger, 1833". World Register of Marine Species. Retrieved 2012-02-09. 
  2. ^ Bohadschia marmorata Marine Species Identification Portal. Retrieved 2012-02-09.
  3. ^ Sea Cucumber or Beche-De-Mer Sea-Ex. Retrieved 2012-02-09.
  4. ^ a b Bohadschia marmorata: Brown Sandfish Cook Islands Biodiversity. Retrieved 2012-02-09.
  5. ^ Rowe, F. W. E.; J. Gates (1995). Echinodermata. Zoological catalogue of Australia. Melbourne: CSIRO. ISBN 0-643-05696-3. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!