Overview
Distribution
Comores, Madagascar, Mascarene Basin, Mauritius, Mozambique, Red Sea, South Africa (country)
-
Drivas, J. & M. Jay (1988). Coquillages de La Réunion et de l'île Maurice
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5910
-
Lamprell, K.L. (1987). Spiny oysters of the world - Spondylus. E.J. Brill/Dr W. Backhuys, Leiden.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6539
-
Michel, C. (1988). Marine molluscs of Mauritius. Editions de l'Ocean Indien. Stanley, Rose Hill. Mauritius
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5908
-
Dautzenberg, Ph. (1923). Liste préliminaire des mollusques marins de Madagascar et description de deux espèces nouvelles. J. conchyliol. 68: 21-74
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5978
-
Dautzenberg, Ph. (1929). Contribution à l'étude de la faune de Madagascar: Mollusca marina testacea. Faune des colonies françaises, III(fasc. 4). Société d'Editions géographiques, maritimes et coloniales: Paris. 321-636, plates IV-VII pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6506
-
Lamprell K.L. (1998). Recent Spondylus species from the Middle East and adjacent regions, with the description of two new species. Vita Marina 45(1-2): 41-60.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6421
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Physical Description
Type Information
Holotype for Spondylus serratissimus Dall et al., 1938
Catalog Number: USNM 337513
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Locality: Oahu, off Honolulu, Hawaii, United States, North Pacific Ocean
Depth (m): 31 to 60
Catalog Number: USNM 337513
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Locality: Oahu, off Honolulu, Hawaii, United States, North Pacific Ocean
Depth (m): 31 to 60
- Holotype: Bull. Bernice P. Bishop Mus. 153: p. 97, pl. 25, fig. 9-12.
© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Trusted
Holotype for Spondylus sparsispinosus Dall et al., 1938
Catalog Number: USNM 190436
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): United States Fish Commission
Locality: in Pailolo Channel, Hawaii, United States, North Pacific Ocean
Depth (m): 238 to 274
Vessel: Albatross R/V
Catalog Number: USNM 190436
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): United States Fish Commission
Locality: in Pailolo Channel, Hawaii, United States, North Pacific Ocean
Depth (m): 238 to 274
Vessel: Albatross R/V
- Holotype: Bull. Bernice P. Bishop Mus. 153: p. 98.
© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Trusted
Ecology
Habitat
Depth range based on 22 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.
Environmental ranges
Depth range (m): 0.5 - 265
Temperature range (°C): 14.581 - 24.911
Nitrate (umol/L): 0.075 - 15.410
Salinity (PPS): 34.555 - 35.409
Oxygen (ml/l): 2.527 - 4.891
Phosphate (umol/l): 0.079 - 1.043
Silicate (umol/l): 0.812 - 17.016
Graphical representation
Depth range (m): 0.5 - 265
Temperature range (°C): 14.581 - 24.911
Nitrate (umol/L): 0.075 - 15.410
Salinity (PPS): 34.555 - 35.409
Oxygen (ml/l): 2.527 - 4.891
Phosphate (umol/l): 0.079 - 1.043
Silicate (umol/l): 0.812 - 17.016
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 8 samples.
Environmental ranges
Depth range (m): 0.5 - 265
Temperature range (°C): 14.581 - 24.911
Nitrate (umol/L): 0.075 - 15.410
Salinity (PPS): 34.555 - 35.409
Oxygen (ml/l): 2.527 - 4.891
Phosphate (umol/l): 0.079 - 1.043
Silicate (umol/l): 0.812 - 17.016
Graphical representation
Depth range (m): 0.5 - 265
Temperature range (°C): 14.581 - 24.911
Nitrate (umol/L): 0.075 - 15.410
Salinity (PPS): 34.555 - 35.409
Oxygen (ml/l): 2.527 - 4.891
Phosphate (umol/l): 0.079 - 1.043
Silicate (umol/l): 0.812 - 17.016
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Spondylus nicobaricus
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
CTTTTGCCTATAATGTTGGGGACTCCTGATATAATGTTCCCACGGTTAAATAACTTTAGGTTTTGGCTTCTTCCAGCAGCTCTTTATATGGTTGCTGTATCTGGGTTTATTGAGGAAGGAAGAGGTACCGGGTGAACGATGTACCCACCATTGTCTAATTCACAATTTCACCCTGGAATTTGTACGGATATAATGATTTTAGGGTTGCACTTGGCTGGGGTTAGGTCTACTGCAGGGGCAATTAACTATCTTGCCACTTTTTTCAATGGGCGTGGGGATTTGTACACTGCAGAGAAGTGTCCTCCATTTGTTTGGGCAATTGTGGTCACTAGGGTTTTGTTGTTGGTGTCTCTTCCTGTGTTAGCGGGAGGTCTTACTATATTGATTTTAGACCGACATTTTAATTGTAGGTTTTTTGACCCAATTGGGGGGGGAGACCCGGTTCTTTTTCAACATTTGTTTTGGTTTTTTGGACATCCTGAGGTTTATGTATTAATTTTACCTGGGTTTGGGATTATTTCTCATGTGTTGGTGTTTTATACTGGTAAGCCTCGTGTCTTTGGGGCCTTAGGGATAATATATGCCATAATTTCTATTGGAATTCTTGGTTTTATTGTGTGGGGCCATCACATATTTACAGTGGGGTTGGATGTAGATACCCGAT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Spondylus nicobaricus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
