Overview

Distribution

Comores, Madagascar, Mascarene Basin, Mauritius, Mozambique, Red Sea, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Holotype for Spondylus serratissimus Dall et al., 1938
Catalog Number: USNM 337513
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Locality: Oahu, off Honolulu, Hawaii, United States, North Pacific Ocean
Depth (m): 31 to 60
  • Holotype: Bull. Bernice P. Bishop Mus. 153: p. 97, pl. 25, fig. 9-12.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Spondylus sparsispinosus Dall et al., 1938
Catalog Number: USNM 190436
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): United States Fish Commission
Locality: in Pailolo Channel, Hawaii, United States, North Pacific Ocean
Depth (m): 238 to 274
Vessel: Albatross R/V
  • Holotype: Bull. Bernice P. Bishop Mus. 153: p. 98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 22 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 0.5 - 265
  Temperature range (°C): 14.581 - 24.911
  Nitrate (umol/L): 0.075 - 15.410
  Salinity (PPS): 34.555 - 35.409
  Oxygen (ml/l): 2.527 - 4.891
  Phosphate (umol/l): 0.079 - 1.043
  Silicate (umol/l): 0.812 - 17.016

Graphical representation

Depth range (m): 0.5 - 265

Temperature range (°C): 14.581 - 24.911

Nitrate (umol/L): 0.075 - 15.410

Salinity (PPS): 34.555 - 35.409

Oxygen (ml/l): 2.527 - 4.891

Phosphate (umol/l): 0.079 - 1.043

Silicate (umol/l): 0.812 - 17.016
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Spondylus nicobaricus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CTTTTGCCTATAATGTTGGGGACTCCTGATATAATGTTCCCACGGTTAAATAACTTTAGGTTTTGGCTTCTTCCAGCAGCTCTTTATATGGTTGCTGTATCTGGGTTTATTGAGGAAGGAAGAGGTACCGGGTGAACGATGTACCCACCATTGTCTAATTCACAATTTCACCCTGGAATTTGTACGGATATAATGATTTTAGGGTTGCACTTGGCTGGGGTTAGGTCTACTGCAGGGGCAATTAACTATCTTGCCACTTTTTTCAATGGGCGTGGGGATTTGTACACTGCAGAGAAGTGTCCTCCATTTGTTTGGGCAATTGTGGTCACTAGGGTTTTGTTGTTGGTGTCTCTTCCTGTGTTAGCGGGAGGTCTTACTATATTGATTTTAGACCGACATTTTAATTGTAGGTTTTTTGACCCAATTGGGGGGGGAGACCCGGTTCTTTTTCAACATTTGTTTTGGTTTTTTGGACATCCTGAGGTTTATGTATTAATTTTACCTGGGTTTGGGATTATTTCTCATGTGTTGGTGTTTTATACTGGTAAGCCTCGTGTCTTTGGGGCCTTAGGGATAATATATGCCATAATTTCTATTGGAATTCTTGGTTTTATTGTGTGGGGCCATCACATATTTACAGTGGGGTTGGATGTAGATACCCGAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Spondylus nicobaricus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!