Physical Description

Diagnostic Description

Description

Distribution: Australia (Lamprell, 1987)
  • Lamprell, K.L. (1987). Spiny oysters of the world - Spondylus. E.J. Brill/Dr W. Backhuys, Leiden.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Spondylus varius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTACTGCCTTTAATGTTGGGGACACCTGATATAAGATTCCCTCGGTTGAATAATTTCAGTTTTTGGCTTTTGCCAGCGGCGTTTTATATAGTTTCGGTTTCTAGGTTTATTGAGGATGGAAGTGGAACGGGGTGGACCATGTATCCTCCTTTATCGGTCTCTGATTTTCATCCGGGAATTTGTACTGATATGATAATCTTGGGTTTGCATTTGGCGGGTGTCAGGTCTACTGCAGGAGCAATTAATTATTTGGCGACATTCTTAAATGGACGTGGGGATCTTTATCCAGCGGAACGGTGTCCTCCTTTTGTGTGGGCTATTGTTGTGACTAGGGTGTTGTTGGTAGTGTCTCTTCCTGTGTTGGCAGGAGGGCTTACAATGTTGCTTTTGGATCGTCACTTCAATTGTAGGTTTTTTGATCCTACTGGAGGAGGAGATCCAGTTCTGTTTCAGCACTTATTTTGATTTTTTGGTCATCCTGAGGTGTACGTATTGATCCTTCCTGGGTTTGGGATTATCTCTCATGTATTGGTGTTCTATACTGGTAAGCCTCGTGTTTTTGGGGCTCTTGGAATAATGTATGCTATAATTTCTATTGGGATTTTAGGGTTCATTGTTTGGGGGCATCATATGTTCACGGTTGGGCTTGATGTGGACACCCGTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Spondylus varius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Spondylus varius

Spondylus varius, is a species of large saltwater clam, a marine bivalve mollusc in the family Spondylidae, the thorny oysters. S. varius reaches a maximum size of about 15-20 cm. It lives at a depths of 30 m, and like most bivalves, is a filter-feeder, using plankton as a food source. This species can be found in the Indo-Pacific Ocean and off Australia, China, the Philippines, Japan, and Taiwan.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!