Ecology

Habitat

Depth range based on 18 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 3 - 67
  Temperature range (°C): 23.011 - 25.591
  Nitrate (umol/L): 0.091 - 0.801
  Salinity (PPS): 34.630 - 35.360
  Oxygen (ml/l): 4.740 - 4.820
  Phosphate (umol/l): 0.082 - 0.190
  Silicate (umol/l): 0.846 - 3.150

Graphical representation

Depth range (m): 3 - 67

Temperature range (°C): 23.011 - 25.591

Nitrate (umol/L): 0.091 - 0.801

Salinity (PPS): 34.630 - 35.360

Oxygen (ml/l): 4.740 - 4.820

Phosphate (umol/l): 0.082 - 0.190

Silicate (umol/l): 0.846 - 3.150
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Spondylus squamosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTCTGCCATTAATGTTGGGGACACCAGATATAATATTCCCTCGTCTTAATAACTTTAGGTTTTGGCTACTTCCGGCAGCATTATATATAGTTGCCATCTCTGGGTTTATTGAGGATGGAAGAGGAACGGGGTGGACTATGTACCCCCCTCTCTCTAATGCGCAGTTTCATCCGGGGATTTGCACAGATATAATGATTCTGGGTCTCCATTTAGCCGGGGTTAGCTCTACTGCTGGTGCTATTAACTACTTGACTACGTTTTTTAACGGCCGTGGTAATTTGTACACTGCAGAGAAGTGCCCGCCGTTCGTGTGGGCAATTGTAGTAACAAGGGTACTGTTGTTAGTCTCTCTACCTGTCTTAGCAGGGGGGTTAACAATATTGATTCTTGATCGACATTTTAATTGCAGGTTTTTTGATCCTGTAGGTGGGGGGGACCCTGTCTTATTCCAACACTTATTCTGGTTTTTTGGGCATCCGGAAGTCTATGTTCTAATCTTACCCGGGTTTGGAATTATTTCCCATGTCTTGGTGTTCTATACCGGAAAGCCTCGTGTTTTTGGGGCTCTTGGAATAATATATGCTATGATTTCTATTGGAATCTTAGGGTTTATTGTCTGGGGGCATCATATATTCACAGTTGGGCTGGATGTAGATACCCGGT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Spondylus squamosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!