Molecular Biology and Genetics

Molecular Biology

Barcode data: Pennithera firmata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACTTCTCTAAGATTATTAATTCGAGCAGAATTAGGTAGCCCAGGATCTTTAATTGGGGATGATCAAATTTATAATACTATTGTGACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGGGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCCCCCTCTATTACTCTTTTAATTTCAAGAAGTATTGTAGAAAATGGAGCTGGAACTGGTTGAACAGTTTACCCCCCTCTTTCCTCTAATATTGCCCACGGAGGAAGATCTGTAGACTTAGCAATTTTTTCTTTACATTTAGCAGGTATCTCTTCTATCTTAGGAGCAATTAATTTTATTACTACTATTATTAATATACGCTTAAACAATATATTTTTTGATCAATTACCTTTATTTGTATGAGCTGTTGGAATCACTGCATTTTTATTACTATTATCTTTACCTGTATTGGCAGGAGCTATTACTATACTTTTAACGGATCGAAATTTAAATACATCTTTTTTTGACCCTGCGGGAGGTGGAGACCCTATTCTTTACCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pennithera firmata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thera firmata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Thera firmata

The Pine Carpet (Thera firmata) is a moth of the Geometridae family. It is found throughout Europe, Anatolia and countries bordering the Caucasus Mountains.

The length of the forewings is 13–16 mm. The ground colour of the forewings is reddish grey.There is with a darker midfield band, indented on the inner edge.The basal field is usually the same colour as the band.The hindwing is whitish brown."It is sometimes, though quite unnecessarily, confused with the brightest reddish forms of obeliscata. Apart from the pectinate male antenna (2 pairs of rather short, slender pectinations to each segment) the paler, more yellowish-tinged hindwing, pale abdomen with red-brown dorsal line, dark subbasal mark along the hindmargin, more deeply angulated antemedian line, more bluish white (or violet-white) subterminal line, usually accompanied by some slight violet-grey shading, and absence of black apical dash all distinguish it. The typical form, which varies very little, inhabits Northern Central Europe, Switzerland and Austria-Hungary._ ulicata Rbr., from S. France, Castile and Lower Austria, has the ground-colour predominantly of the pale violet-grey or blue-grey tone and the median band darkened." [1]

The moth flies in two generations from August to mid October [1].

The larva feed on pine.

Notes[edit]

  1. ^ The flight season refers to Belgium and The Netherlands. This may vary in other parts of the range.

References[edit]

  1. ^ Prout , L.B. 1912–16. Geometridae. In A. Seitz (ed.) The Macrolepidoptera of the World. The Palaearctic Geometridae, 4. 479 pp. Alfred Kernen, Stuttgart.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!