Molecular Biology and Genetics

Molecular Biology

Barcode data: Thera cognata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGTATTTGAGCTGGAATAATTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATCTTTAATTGGGGACGACCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATACTTGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATGAGATTTTGGTTATTGCCCCCCTCAATTACCCTTTTAATCTCGAGAAGTATCGTCGAAAATGGAGCTGGAACTGGATGAACTGTTTACCCCCCTCTTTCCTCTAATATTGCCCATGGAGGAAGATCCGTAGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCTTCAATTTTAGGAGCAATTAATTTCATCACTACTATTATTAATATACGATTAAACAATATATTTTTTGACCAATTACCTTTATTTGTATGAGCTGTTGGAATTACAGCATTTTTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACAATATTATTAACTGACCGAAACTTAAATACATCTTTTTTTGACCCTGCTGGTGGAGGAGACCCCATTCTTTACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thera cognata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Thera cognata

The Chestnut-coloured Carpet or Durham Juniper Moth (Thera cognata) is a moth of the Geometridae family. It is found in Europe, Asia Minor, the Caucasus and Transcaucasus.

Illustration from John Curtis's British Entomology Volume 6

The wingspan is 26–30 mm. The forewings are reddish-brown. The median band and the basal field are darker in color and these dark fields are delimited with black and white cross lines. The hindwings are whitish. Thera cognata is easily distinguished from Thera variata by its strong purple-brown or red-brown gloss. Hindwing a little more glossy than in Thera obeliscata.The typical northern form is rather small and in general dark reddish. - geneata Feisth., the prevailing form in the Alps and in Transcaucasia, perhaps also in the Pyrenees, is larger, somewhat paler and with a less definite red tinge, the ground-colour being somewhat mixed with violet or purplish. — ab. perversa Hirschke is an aberration of geneata, from the Franzenshohe, in which the basal and median areas of the forewing, instead of being darker than the ground colour of the wings, are lighter. [1]

Adults are on wing from July to August in one generation.

The larvae feed on Juniperus species.

Subspecies[edit]

References[edit]

  1. ^ Prout , L.B. 1912–16. Geometridae. In A. Seitz (ed.) The Macrolepidoptera of the World. The Palaearctic Geometridae, 4. 479 pp. Alfred Kernen, Stuttgart.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!