Molecular Biology and Genetics

Molecular Biology

Barcode data: Thera cognata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGTATTTGAGCTGGAATAATTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATCTTTAATTGGGGACGACCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATACTTGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATGAGATTTTGGTTATTGCCCCCCTCAATTACCCTTTTAATCTCGAGAAGTATCGTCGAAAATGGAGCTGGAACTGGATGAACTGTTTACCCCCCTCTTTCCTCTAATATTGCCCATGGAGGAAGATCCGTAGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCTTCAATTTTAGGAGCAATTAATTTCATCACTACTATTATTAATATACGATTAAACAATATATTTTTTGACCAATTACCTTTATTTGTATGAGCTGTTGGAATTACAGCATTTTTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACAATATTATTAACTGACCGAAACTTAAATACATCTTTTTTTGACCCTGCTGGTGGAGGAGACCCCATTCTTTACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thera cognata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Thera cognata

The Chestnut-coloured Carpet or Durham Juniper Moth (Thera cognata) is a moth of the Geometridae family. It is found in Europe, Asia Minor, the Caucasus and Transcaucasus.

Illustration from John Curtis's British Entomology Volume 6

The wingspan is 26–30 mm. Adults are on wing from July to August in one generation.

The larvae feed on Juniperus species.

Subspecies[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!