Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Ceranthia abdominalis is endoparasitoid of larva of Thera britannica

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thera britannica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGTATTTGAGCCGGAATAATTGGTACCTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACGGCTCATGCCTTTATTATAATTTTTTTTATAGTTATGCCAATCATAATTGGGGGATTTGGTAACTGACTAGTTCCCCTAATATTGGGGGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTGCTGCCCCCCTCAATTACTCTTTTAATCTCAAGAAGTATCGTAGAAAATGGGGCTGGAACTGGTTGAACTGTTTACCCCCCTCTTTCATCTAATATCGCCCATGGAGGTAGATCTGTAGATTTGGCAATTTTTTCTCTTCATTTAGCTGGTATTTCTTCAATTTTAGGAGCAATTAATTTTATTACTACTATTATCAATATACGTTTGAATAATATATTTTTTGATCAATTACCTTTATTCGTATGAGCTGTTGGAATTACGGCATTTTTATTATTATTATCTTTACCCGTATTAGCTGGAGCTATTACAATATTACTAACTGATCGAAATTTAAACACATCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTCTTTATCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thera britannica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Spruce Carpet

The Spruce Carpet (Thera britannica) is a species of moth. It is a double-brooded species, meaning it has two broods in one year. Its wings are colored with different shades of gray, but the spring brood tends to have more brown colors.

Distribution[edit]

Found from the British Isles and France through Central Europe to the North of the Carpathian Mountains. In the North to the South of Scandinavia. In the South there are isolated occurrences in the Pyrenees, in Corsica, on the Italian peninsula, in the Carpathians and in the mountains of Greece (including Peloponnese) as well as in Bulgaria. The species is more common than in the southern areas in the northern regions of the Alps. Outside of Europe, there are confirmed reports from the Northwest and northeast of Turkey, Transcaucasia and the Caucasus.

Description[edit]

Its wingspan is about 30–36 mm.Very similar to Grey Pine Carpet, but is usually more richly marked and greyer in appearance. The ground colour of the forewing varies between light grey to blackish grey.Within the median band there are individual dark brown reddish-brown stains (shapes) which are often marked with a white border.Three or more of these shapes are ovoid areas located towards the trailing edge. The median band is fluted and normally edged narrowly with white.The sub-terminal line is generally well marked.The spring brood is an overall brown rather than grey. Important differential characters are the white marginal line to central band, the distinct sub-terminal line and the dark grey brown hindwings.

Its flight periods are April to late June (spring brood) and from the end of August to mid October (autumn brood). The larva feeds on Picea abies and Pseudotsuga menziesii.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!