Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Ceranthia abdominalis is endoparasitoid of larva of Thera britannica

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thera britannica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGTATTTGAGCCGGAATAATTGGTACCTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACGGCTCATGCCTTTATTATAATTTTTTTTATAGTTATGCCAATCATAATTGGGGGATTTGGTAACTGACTAGTTCCCCTAATATTGGGGGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTGCTGCCCCCCTCAATTACTCTTTTAATCTCAAGAAGTATCGTAGAAAATGGGGCTGGAACTGGTTGAACTGTTTACCCCCCTCTTTCATCTAATATCGCCCATGGAGGTAGATCTGTAGATTTGGCAATTTTTTCTCTTCATTTAGCTGGTATTTCTTCAATTTTAGGAGCAATTAATTTTATTACTACTATTATCAATATACGTTTGAATAATATATTTTTTGATCAATTACCTTTATTCGTATGAGCTGTTGGAATTACGGCATTTTTATTATTATTATCTTTACCCGTATTAGCTGGAGCTATTACAATATTACTAACTGATCGAAATTTAAACACATCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTCTTTATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thera britannica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Spruce Carpet

The Spruce Carpet (Thera britannica) is a species of moth. Its wingspan is about 30–36 mm. It is a double-brooded species, meaning it has two broods in one year. Its wings are colored with different shades of gray, but the spring brood tends to have more brown colors. It is attracted to spruce trees. Its flight periods are April to late June (spring brood) and from the end of August to mid October (autumn brood).

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!