Ecology

Habitat

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 15 - 15
  Temperature range (°C): 24.646 - 24.646
  Nitrate (umol/L): 0.041 - 0.041
  Salinity (PPS): 35.254 - 35.254
  Oxygen (ml/l): 4.754 - 4.754
  Phosphate (umol/l): 0.111 - 0.111
  Silicate (umol/l): 1.376 - 1.376
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Caloria indica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATTGATTCGGTTTGAATTGGGGACAGCGGGTGCTCTTCTTGGTGAT---GACCACCTGTATAATGTAATTGTAACAGCGCATGCGTTCGTTATAATTTTTTTTATGGTAATACCCCTAATGATTGGCGGTTTTGGGAACTGAATGGTCCCTTTATTATTAGGAGCCCCTGATATAAGATTTCCTCGAATAAATAATATAAGATTTTGGTTACTTCCTCCTTCTTTTATTTTATTAATGTCTTCTACTCTGATAGAAGGTGGGGCTGGGACTGGATGAACTGTATACCCTCCCTTGTCAGGAGCTATTGGTCATGGAGGATGTTCTGTGGACTTAGCCATTTTTTCTCTTCATTTAGCGGGGATGTCTTCTCTATTAGGAGCTATTAATTTTATCACTACTATTTTCAATATACGTTCTCCTGAGATAACAATAGATCGATTAAGTTTGTTCGTTTGGTCAGTTTTAGTTACGGCTTTTCTCTTGTTATTATCTCTTCCCGTTCTGGCGGGAGCAATTACTATGCTTCTTACCGATCGGAATTTTAATACTAGATTCTTTGATCCGGCTGGGGGTGGGGACCCAATTCTATATCAACATTTATTTTGATTTTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Caloria indica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Caloria indica

Caloria indica is a species of sea slug, an aeolid nudibranch, a marine gastropod mollusc in the family Facelinidae.[2][3]

References

  1. ^ a b Bergh L. S. R. (1896). "Eolidiens d'Amboine. Voyage de MM. M. Bedot et C. Pictet dans l'Archipel Malais". Revue Suisse de Zoologie 4: 385-394, Plate 16.
  2. ^ a b Gofas, S. (2009). Caloria indica (Bergh, 1896). In: Bouchet, P.; Gofas, S.; Rosenberg, G. (2009) World Marine Mollusca database. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=181240 on 2010-05-18
  3. ^ "Caloria indica". CLEMAM. accessed 19 May 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!