Ecology

Habitat

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 3.5 - 30
  Temperature range (°C): 17.140 - 17.140
  Nitrate (umol/L): 0.211 - 0.211
  Salinity (PPS): 37.926 - 37.926
  Oxygen (ml/l): 5.513 - 5.513
  Phosphate (umol/l): 0.131 - 0.131
  Silicate (umol/l): 1.247 - 1.247

Graphical representation

Depth range (m): 3.5 - 30
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lithophaga lithophaga

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTGGTACTCTTTATTNACTGGTGGGGTTTTGGGCGGGATTAGTTGGGATAAGTCTAAGTTTAATTATTCGGCTTCAATTAGGCCGTCCTGGGGGGTTTCTTCATAGT---GATCACTTATATAACGTAATTGTGACTTCTCATGGGCTGATTATGATTTTTTTTATAGTGATGCCTTTGATGGTCGGTGCCTTTGGGAATTGGCTTATTCCTATAATGATTGGGTCTAGGGATATAATTTTTCCACGGGTAAATAATCTTAGATTTTGGTTAATTCCTTGTGCGCTCTATTTATTACTGTTCTCTCTTTTTGTTGAGGGGGGAGCTGGAACTGGTTGAACTATATATCCTCCTTTGTCGTCTAATGCGGGTCATAGAAGACCTGCTGTTGATTTGGTGATTTTTTCTATCCATTTATCGGGGGTCTCGTCTATTTTGGCGTCTATCAATTTTTTAGTAACGGTAAAAAATTGTCCTGTAAAGGCGCTTAAAGGGGAGCGTATGGTCCCTTTTGTGTGGGGGGTGACTGTGACTACAGCTCTTCTATTGCTGGCAATGCCGGTGTTAGCGGGTGCAGTTACAATGTTATTAATGGATCGAAACTTTAATACGACTTTTTATGATTCGCGTGGAGGGGGGGATCCGGTGCTTTTTATGCATCTTTTCTGATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lithophaga lithophaga

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lithophaga lithophaga

Lithophaga lithophaga, also known as date shells or date mussels,[2] are a species of Bivalvia. They can be found in northeast Atlantic Ocean, the Mediterranean Sea and the Red Sea.[3] They are found on the Adriatic coast of Croatia and Montenegro under the name prstaci.[4] They bore into marine rocks, producing a boring called Gastrochaenolites.

Several governments have restricted the collection of these shells or even made it wholly illegal, in order to protect the rocks on which they are found. The extraction of the shells from the rocks leads to desertification of the coast. These countries include Croatia,[5] Italy,[3] Slovenia,[6] France,[7] Greece,[3] Montenegro,[3] and others, including participants in the Convention on the Conservation of European Wildlife and Natural Habitats (Bern Convention)[8] and the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES).[2][6] As of 2004, its population distributed over the Turkish coastline is not considered to be under threat.[3]

Historically these shells are considered a delicacy, cooked and served in a broth of white wine, garlic and parsley.

References

  1. ^ Serge Gofas (2010). "Lithophaga lithophaga (Linnaeus, 1758)". In P. Bouchet, S. Gofas & G. Rosenberg. World Marine Mollusca database. World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=140459. Retrieved January 20, 2012.
  2. ^ a b "Lithophaga lithophaga Identification Sheet 004" (PDF). Environment Canada. http://www.ec.gc.ca/alef-ewe/A1CFAE57-5DF9-4CD3-B51D-163E27368883/004_lithophaga_lithophaga_ENG_rev9_HR.pdf. Retrieved 2010-05-29.[dead link]
  3. ^ a b c d e Italy and Slovenia (on behalf of the Member States of the European Community). "CoP13 Prop. 35 Inclusion of Lithophaga lithophaga in Appendix II, in accordance with Article II, paragraph 2 (a)." (PDF). CITES. http://www.cites.org/eng/cop/13/prop/e13-p35.pdf. Retrieved 2010-06-20.
  4. ^ BIUS – Udruga studenata biologije (2001-07-26). "Prstaci (Lithophaga lithophaga)". University of Zagreb Faculty of Science Division of Biology. http://zg.biol.pmf.hr/~bius/more/prstaci.html. Retrieved 2010-05-06.
  5. ^ Croatian Parliament (1997-05-05). "Zakon o morskom ribarstvu" (in Croatian). Narodne novine 46/1997. http://narodne-novine.nn.hr/clanci/sluzbeni/266331.html. Retrieved 2010-05-29. "Radi zaštite hridinaste obale kao posebnog staništa ribolovnog mora zabranjen je izlov prstaca i zabranjeno je njihovo stavljanje u promet na cijelom teritoriju Republike Hrvatske, kao i njihov izvoz."
  6. ^ a b "Identification manual" (PDF). CITES Secretariat. 2007-06-15. http://www.cites.org/eng/cop/14/doc/E14-44.pdf. Retrieved 2010-05-29.
  7. ^ "Lithophaga lithophaga (Linnaeus, 1758)" (in French). GIS Posidonie. 2003-03-13. http://www.com.univ-mrs.fr/gisposi/spip.php?article105. Retrieved 2010-06-20. "Protection  : Interdiction de la pêche en France par arrêté du 26 novembre 1992."
  8. ^ "Appendix II - Strictly protected fauna species". Convention on the Conservation of European Wildlife and Natural Habitats. Council of Europe. 2002-03-01. http://conventions.coe.int/treaty/FR/Treaties/Html/104-2.htm. Retrieved 2010-06-20. "Molluscs - Bivalvia - Mytiloida - Lithophaga lithophaga (Med.)"
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!