Overview
Comprehensive Description
In dense clusters byssally attached to hard substrate around the hydrothermal vent, mostly on the walls and flanges of active edifices, at temperatures from 6° to up to 30°C. Endemic to vents. Development with long planktonic larval phase; protoconch is 0.5 mm long.
- COMTET T., LE PENNEC M. & D. DESBRUYÈRES (1999) J. Mar. Biol. Ass. U.K. 79: 1149-1150.
Trusted
Distribution
European waters (ERMS scope)
-
Gofas, S.; Le Renard, J.; Bouchet, P. (2001). Mollusca, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 180-213
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=1364
Trusted
Mid-Atlantic Ridge: Menez Gwen, Lucky Strike, Rainbow (hybrids between B. azoricus and B. puteoserpentis were observed at Broken Spur vent field).
- COMTET T., LE PENNEC M. & D. DESBRUYÈRES (1999) J. Mar. Biol. Ass. U.K. 79: 1149-1150.
Trusted
Physical Description
Morphology
Shell variable, more or less elongate-modioliform, beaks subterminal but close to the anterior margin. Ventral margin straight to more or less concave. Postero-dorsal margin slightly to markedly convex, occasionally straight. Ligament plate slightly arched. Exterior with dense irregular growth lines and growth waves. Periostracum dull, warm chestnut brown, in umbonal region and often also postero-dorsally lighter brown. Anterior byssus retractor scar in the umbonal cavity, under the beaks. Anterior part of posterior byssus retractor muscle scar under ligament?s end or slightly forward. Animal with large gills. Mantle lobes on anterior half of ventral side separate. Valvular siphonal membrane short, narrow and rather strong.
- COMTET T., LE PENNEC M. & D. DESBRUYÈRES (1999) J. Mar. Biol. Ass. U.K. 79: 1149-1150.
Trusted
Size
Shell length up to 121 mm.
- COMTET T., LE PENNEC M. & D. DESBRUYÈRES (1999) J. Mar. Biol. Ass. U.K. 79: 1149-1150.
Trusted
Type Information
Paratype for Bathymodiolus azoricus Cosel & Comtet in Cosel et al., 1999
Catalog Number: USNM 1129903
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): A. Alayse
Year Collected: 1995
Locality: Mid-Atlantic Ridge, Azores Triple Junction, Menez Gwen hydrothermal field, North Atlantic Ocean
Depth (m): 866
Catalog Number: USNM 1129903
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): A. Alayse
Year Collected: 1995
Locality: Mid-Atlantic Ridge, Azores Triple Junction, Menez Gwen hydrothermal field, North Atlantic Ocean
Depth (m): 866
- Paratype: Cosel, R., et al. 1999. Bathymodiolus (Bivalvia: Mytilidae) from Hydrothermal Vents on the Azores Triple Junction and the Logatchev Hydrothermal Field, Mid-Atlantic Ridge. The Veliger. 42 (3): 218-248.
Trusted
Ecology
Habitat
Depth range based on 170 specimens in 1 taxon.
Water temperature and chemistry ranges based on 170 samples.
Environmental ranges
Depth range (m): 810 - 2300
Temperature range (°C): 3.279 - 9.211
Nitrate (umol/L): 17.840 - 18.601
Salinity (PPS): 34.979 - 35.419
Oxygen (ml/l): 4.413 - 6.060
Phosphate (umol/l): 1.114 - 1.225
Silicate (umol/l): 10.356 - 19.959
Graphical representation
Depth range (m): 810 - 2300
Temperature range (°C): 3.279 - 9.211
Nitrate (umol/L): 17.840 - 18.601
Salinity (PPS): 34.979 - 35.419
Oxygen (ml/l): 4.413 - 6.060
Phosphate (umol/l): 1.114 - 1.225
Silicate (umol/l): 10.356 - 19.959
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 170 samples.
Environmental ranges
Depth range (m): 810 - 2300
Temperature range (°C): 3.279 - 9.211
Nitrate (umol/L): 17.840 - 18.601
Salinity (PPS): 34.979 - 35.419
Oxygen (ml/l): 4.413 - 6.060
Phosphate (umol/l): 1.114 - 1.225
Silicate (umol/l): 10.356 - 19.959
Graphical representation
Depth range (m): 810 - 2300
Temperature range (°C): 3.279 - 9.211
Nitrate (umol/L): 17.840 - 18.601
Salinity (PPS): 34.979 - 35.419
Oxygen (ml/l): 4.413 - 6.060
Phosphate (umol/l): 1.114 - 1.225
Silicate (umol/l): 10.356 - 19.959
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Bathymodiolus azoricus
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 99 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 99 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TTATATATTTTACTGGGGCTGTGGTCTGGAATAATTGGAACAAGTTTAAGGTTACTAATTCGTATTGAATTAGCACGTCCCGGAAGGTTTTTGGGGGAT---GATCAGCTTTATAATGTTATTGTAACTGCTNACGCTTTAGTTATAATTTTTTTTATAGTTATGCCTTTGATAGTTGGTGGGTTCGGAAATTGGTTGTTGCCTTTGATAATGGGTTCAATTGACATAATTTTTCCCCGTTTAAACAATCTGAGATTTTGGTTTTTGCCTGCATCTCTATTTACTCTTTTGTTGTCAACATTTATTGAGAGTGGGTCCGGAACTGGGTGAACTTTGTACCCTCCTTTGTCTNCTTATACTGGGCATAGGGGCCCAGCAGTTGATATATCATTATTTTCTCTTCATTTAGCAGGTGCCTCTTCTATCGGGGGCTCAATCAATTTTCTTACTAGTATGAAGAATATGTCTGTTGAGAGTATGCGAGGGGAGCGAAATGTTTTATTTGTTTGATCTATGGCTGTAACNGCAGTATTATTATTAGTTTCTTTACCTGTATTAGCTGGGGGGATTACTATGTTGAATTTTGATCGTCAATTCAATACATCTTTTTATGACCCTAAAGGTCGGGGAGAGCCTGATTTATACCAA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Bathymodiolus azoricus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 97
Specimens with Barcodes: 97
Species With Barcodes: 1
Public Records: 97
Specimens with Barcodes: 97
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!

