Overview

Comprehensive Description

In dense clusters byssally attached to hard substrate around the hydrothermal vent, mostly on the walls and flanges of active edifices, at temperatures from 6° to up to 30°C. Endemic to vents. Development with long planktonic larval phase; protoconch is 0.5 mm long.
  • COMTET T., LE PENNEC M. & D. DESBRUYÈRES (1999) J. Mar. Biol. Ass. U.K. 79: 1149-1150.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

European waters (ERMS scope)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mid-Atlantic Ridge: Menez Gwen, Lucky Strike, Rainbow (hybrids between B. azoricus and B. puteoserpentis were observed at Broken Spur vent field).
  • COMTET T., LE PENNEC M. & D. DESBRUYÈRES (1999) J. Mar. Biol. Ass. U.K. 79: 1149-1150.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Shell variable, more or less elongate-modioliform, beaks subterminal but close to the anterior margin. Ventral margin straight to more or less concave. Postero-dorsal margin slightly to markedly convex, occasionally straight. Ligament plate slightly arched. Exterior with dense irregular growth lines and growth waves. Periostracum dull, warm chestnut brown, in umbonal region and often also postero-dorsally lighter brown. Anterior byssus retractor scar in the umbonal cavity, under the beaks. Anterior part of posterior byssus retractor muscle scar under ligament?s end or slightly forward. Animal with large gills. Mantle lobes on anterior half of ventral side separate. Valvular siphonal membrane short, narrow and rather strong.
  • COMTET T., LE PENNEC M. & D. DESBRUYÈRES (1999) J. Mar. Biol. Ass. U.K. 79: 1149-1150.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Shell length up to 121 mm.
  • COMTET T., LE PENNEC M. & D. DESBRUYÈRES (1999) J. Mar. Biol. Ass. U.K. 79: 1149-1150.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Bathymodiolus azoricus Cosel & Comtet in Cosel et al., 1999
Catalog Number: USNM 1129903
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): A. Alayse
Year Collected: 1995
Locality: Mid-Atlantic Ridge, Azores Triple Junction, Menez Gwen hydrothermal field, North Atlantic Ocean
Depth (m): 866
  • Paratype: Cosel, R., et al. 1999. Bathymodiolus (Bivalvia: Mytilidae) from Hydrothermal Vents on the Azores Triple Junction and the Logatchev Hydrothermal Field, Mid-Atlantic Ridge. The Veliger. 42 (3): 218-248.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 170 specimens in 1 taxon.
Water temperature and chemistry ranges based on 170 samples.

Environmental ranges
  Depth range (m): 810 - 2300
  Temperature range (°C): 3.279 - 9.211
  Nitrate (umol/L): 17.840 - 18.601
  Salinity (PPS): 34.979 - 35.419
  Oxygen (ml/l): 4.413 - 6.060
  Phosphate (umol/l): 1.114 - 1.225
  Silicate (umol/l): 10.356 - 19.959

Graphical representation

Depth range (m): 810 - 2300

Temperature range (°C): 3.279 - 9.211

Nitrate (umol/L): 17.840 - 18.601

Salinity (PPS): 34.979 - 35.419

Oxygen (ml/l): 4.413 - 6.060

Phosphate (umol/l): 1.114 - 1.225

Silicate (umol/l): 10.356 - 19.959
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bathymodiolus azoricus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 99 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATATATTTTACTGGGGCTGTGGTCTGGAATAATTGGAACAAGTTTAAGGTTACTAATTCGTATTGAATTAGCACGTCCCGGAAGGTTTTTGGGGGAT---GATCAGCTTTATAATGTTATTGTAACTGCTNACGCTTTAGTTATAATTTTTTTTATAGTTATGCCTTTGATAGTTGGTGGGTTCGGAAATTGGTTGTTGCCTTTGATAATGGGTTCAATTGACATAATTTTTCCCCGTTTAAACAATCTGAGATTTTGGTTTTTGCCTGCATCTCTATTTACTCTTTTGTTGTCAACATTTATTGAGAGTGGGTCCGGAACTGGGTGAACTTTGTACCCTCCTTTGTCTNCTTATACTGGGCATAGGGGCCCAGCAGTTGATATATCATTATTTTCTCTTCATTTAGCAGGTGCCTCTTCTATCGGGGGCTCAATCAATTTTCTTACTAGTATGAAGAATATGTCTGTTGAGAGTATGCGAGGGGAGCGAAATGTTTTATTTGTTTGATCTATGGCTGTAACNGCAGTATTATTATTAGTTTCTTTACCTGTATTAGCTGGGGGGATTACTATGTTGAATTTTGATCGTCAATTCAATACATCTTTTTATGACCCTAAAGGTCGGGGAGAGCCTGATTTATACCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bathymodiolus azoricus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 97
Specimens with Barcodes: 97
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!