Molecular Biology and Genetics

Molecular Biology

Barcode data: Thera variata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGTATTTGAGCCGGAATAATTGGTACCTCTTTAAGACTATTAATTCGAGCTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACGGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCAATCATAATTGGGGGATTTGGTAACTGACTAGTTCCCCTAATATTGGGGGCCCCTGATATAGCTTTCCCTCGGATAAATAATATAAGATTTTGATTACTGCCCCCCTCAATTACTCTTTTAATCTCAAGAAGTATTGTAGAAAATGGGGCTGGAACTGGTTGAACTGTTTACCCCCCTCTTTCATCTAATATTGCCCATGGAGGTAGATCTGTAGATTTGGCAATTTTTTCTCTTCATTTAGCTGGTATTTCTTCAATTTTAGGAGCAATTAATTTTATTACTACTATTATCAATATACGTTTGAATAATATATTTTTTGATCAATTACCTTTATTCGTATGAGCTGTTGGAATTACAGCATTTTTATTATTATTATCTTTACCCGTATTAGCTGGAGCTATTACAATATTACTAACTGATCGAAACTTAAACACATCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTCTTTATCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thera variata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 53
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Thera variata

The Spruce Carpet (Thera variata) is a moth of the family Geometridae. It is found throughout Europe, North Asia and Japan. The Common name Spruce Carpet is also used when referring to Thera britannica.

The length of the forewings is 13–17 mm. The moth flies in two generations from mid April to mid October [1].

The larva feed on spruce and other Pinophyta.

Notes[edit]

  1. ^ The flight season refers to Belgium and The Netherlands. This may vary in other parts of the range.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!