Molecular Biology and Genetics

Molecular Biology

Barcode data: Chromodoris luteorosea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTTCTTGGAATATGATGTGGTCTGGTAGGAACTGGGTTAAGATTACTAATTCGCTTTGAACTAGGGACTGCAGGAGCATTTTTAGGTGAT---GATCATTTTTATAATGTGATTGTTACAGCTCATGCGTTTGTAATAATTTTTTTTATAGTTATACCCTTAATAATTGGTGGCTTTGGAAATTGAATGGTACCATTACTTATTGGGGCGCCGGATATGAGATTTCCTCGTATAAATAACATAAGCTTTTGATTGCTACCTCCATCATTTATTTTATTATTATGTTCCACTCTGATGGAAGGGGGTGCGGGGACAGGATGGACTGTATATCCTCCTCTTTCTGGGTCAGTAGCTCATGGTGGTACYTCAGTTGATTTAGCTATTTTTTCATTACATTTAGCTGGTGCCTCTTCTTTATTGGGAGCTATTAATTTTATTACTACAATTTTTAACATACGTTCTACTGCAATAACAATGGAACGTTTAAGACTATTTGTTTGATCAGTATTAGTAACTGCGTTCTTGTTATTGTTGTCTCTTCCAGTGTTGGCAGGGGCTATTACTATGTTGTTAACAGATCGAAATTTTAATACTAGATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chromodoris luteorosea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Felimida luteorosea

Felimida luteorosea is a species of colorful sea slug, a dorid nudibranch, a marine gastropod mollusk in the family Chromodorididae.[1][2]

Description[edit]

The size of the body varies between 30 mm and 55 mm.

Distribution[edit]

This species occurs in European waters (Spain, Portugal), the Mediterranean Sea (Greece) and in the Atlantic Ocean off Angola.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!