Physical Description

Type Information

Syntype for Aglaja pelsunca Marcus & Marcus, 1966
Catalog Number: USNM 576259
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Locality: Gulf of Guinea, North Atlantic Ocean
Vessel: Pillsbury R/V
  • Syntype: Stud. Trop. Oceanogr. 4(1): 171, fig. 29-32.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Aglaja pelsunca Marcus & Marcus, 1966
Catalog Number: USNM 576258
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Locality: Gulf of Guinea, North Atlantic Ocean
Vessel: Pillsbury R/V
  • Syntype: Stud. Trop. Oceanogr. 4(1): 171, fig. 29-32.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Philinopsis depicta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACATTATATATAATCTTCGGAATGTGGTGTGGTCTTGTAGGGACTGGGCTGAGTTTATTAATTCGTTTTGAATTAGGAACAGCTTCTGCTTTTTTAGGTGAT---GATCATTTTTATAATGTTATTGTTACAGCTCATGCCTTTGTAATGATTTTTTTTATAGTAATACCCTTAATAATTGGAGGATTTGGTAATTGAATAGTACCTCTTTTAATTGGAGCTCCTGATATAAGGTTTCCCCGAATAAATAATATAAGGTTTTGATTATTACCTCCTTCTTTTACCTTGCTACTTGTGTCTAGTATAGTAGAAGGAGGGGCTGGAACAGGGTGGACTGTTTACCCCCCTCTGTCGGGTCCTATTGCTCATGGATCACCATCAGTAGACTTAGTAATTTTTTCTCTTCACTTAGCAGGGATATCTTCTATTTTAGGAGCGATTAATTTTATTACTACAATTCTTAATATGCGAGCCCCTGGAATTATTTTTGAACGACTAAGCTTATTTGTTTGATCTATCTTAGTAACAGCTTTCTTATTGCTTCTCTCTCTTCCTGTTTTAGCAGGTGCAATTACTATACTTTTAACTGACCGTAATTTTAATACTAGGTTTTTCGACCCTGCTGGGGGAGGGGACCCTATTTTATACCAGCACCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Philinopsis depicta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!