Molecular Biology and Genetics

Molecular Biology

Barcode data: Deileptenia ribeata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCCCCATCTATTACTTTACTAATTTCTAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCGCCTCTATCTTCGAATATTGCTCATGGAGGAAGTTCAGTAGATTTAGCAATTTTTTCCCTTCATTTAGCTGGTATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAACATACGATTAAATAATCTATCATTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCATTTTTACTACTTTTATCACTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGACCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Deileptenia ribeata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Deileptenia ribeata

The Satin Beauty (Deileptenia ribeata) is a moth of the Geometridae family. It is found from Ireland, east through central Europe to Russia and Japan.

Illustration from John Curtis's British Entomology Volume 6

The wingspan is 30–40 mm. Adults are on wing from June to August. There is one generation per year.

Larvae feed on various coniferous trees, including Taxus baccata, Abies alba, Carpinus betulus, Betula, Quercus, Prunus spinosa, Vaccinium uliginosum, Lonicera xylosteum and Picea.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!