Overview

Comprehensive Description

Description

 The carapace of Liocarcinus depurator is wider than long, about 51 mm wide and 40 mm long. The species is immediately recognised by the violet-tinted paddle of the fifth leg in larger crabs. The rest of the body is pale reddish-brown with transverse rows of hairs on the carapace, most conspicuous towards the rear.Other common names include the 'swimming crab'.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 402 specimens in 1 taxon.
Water temperature and chemistry ranges based on 96 samples.

Environmental ranges
  Depth range (m): 0 - 390
  Temperature range (°C): 6.506 - 16.189
  Nitrate (umol/L): 2.036 - 12.110
  Salinity (PPS): 31.839 - 38.792
  Oxygen (ml/l): 4.403 - 6.461
  Phosphate (umol/l): 0.132 - 0.808
  Silicate (umol/l): 1.612 - 10.823

Graphical representation

Depth range (m): 0 - 390

Temperature range (°C): 6.506 - 16.189

Nitrate (umol/L): 2.036 - 12.110

Salinity (PPS): 31.839 - 38.792

Oxygen (ml/l): 4.403 - 6.461

Phosphate (umol/l): 0.132 - 0.808

Silicate (umol/l): 1.612 - 10.823
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Found on the lower shore and sublittoral on fine, muddy sand and gravel.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Liocarcinus depurator

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 37
Specimens with Barcodes: 54
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Liocarcinus depurator

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCAACAAATCATAAAGATATTGGTACATTATATTTTATTTTCGGTGCTTGAGCAGGTATAGTAGGGACTTCTCTAAGTTTAATTATTCGTGCTGAGTTGGGTCAGCCTGGTACATTAATTGGTAAT---GACCAGATTTACAACGTTGTTGTTACTGCACACGCCTTTGTAATAATCTTTTTTATGGTAATACCTATTATAATTGGGGGATTTGGTAATTGACTTGTCCCCCTTATGTTAGGAGCTCCTGACATAGCCTTCCCCCGTATAAATAATATAAGGTTCTGATTACTCCCACCTTCGCTAACTCTTCTCCTCATAAGAGGCATAGTTGAAAGAGGTGTTGGTACTGGATGAACTGTCTACCCTCCCCTATCGGCTGCTATTGCCCATGCTGGTGCTTCAGTAGACCTGGGTATTTTCTCTCTTCATTTAGCGGGTGTTTCTTCTATTTTAGGTGCCGTTAATTTTATAACAACGGTTATTAATATACGTTCTTTTGGTATAATGATAGATCAAATACCTTTGTTTGTCTGAGCTGTCTTTATTACTGCCATCCTTCTTTTACTATCCTTACCTGTCTTAGCAGGTGCCATTACCATACTTCTTACTGATCGTAATTTGAATACTTCTTTCTTCGACCCCGCTGGGGGAGGTGACCCTGTTCTTTATCAACATTTATTCTGATTTTTTGGTCACCCTGAAGTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Liocarcinus depurator

Liocarcinus depurator, sometimes called the harbour crab[2] or sandy swimming crab,[3] is a species of crab found in the North Sea, Atlantic Ocean, Mediterranean Sea, and Black Sea.[4] It grows up to 50 millimetres (2.0 in) in width and 40 mm (1.6 in) long,[5] and can be distinguished from other crabs, such as the shore crab Carcinus maenas, by the curved rows of white spots on its carapace.[2]

The species was first described by Carl Linnaeus in 1758, in his 10th edition of Systema Naturae. It has a synonym, Portunus plicatus, which was given by Antoine Risso in 1816.[1]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!