Overview
Distribution
Azores Exclusive Economic Zone, East American Coast, East Atlantic, East Mediterranean, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Gabès, Israeli part of the Mediterranean Sea - Eastern Basin, Japan, Madagascar, Mediterranean Sea, New Zealand, Philippines, Red Sea, South Africa (country), South East Atlantic
-
Lewinsohn, C. (1969). Die Anomuren des Roten Meeres (Crustacea Decapoda: Paguridae, Galatheidae, Hippidae). Zoologische Verhandelingen (Rijksmuseum van Natuurlijke Historie, Leiden) 104. 213 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5994
-
Derijard, R. (1966). Note preliminaire sur les crustaces stomatopodes et decapodes recoltes a l'ile Europa du 6 au 24 Avril 1964. Mem Mus Natn Hist Nat, Paris 4 (41): 159-180
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6015
-
L. B. Holthuis & E. Gottlies(1958) An annotated list of Decapod Crustacea of the Mediterranean Coast of Israel, with an appendix listing the Decapoda of the Eastern Mediterranean. Bulletin of the Research Council of Israel. Haifa, Israel. 1-126pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=42367
-
Emmerson W.D. A comparison between decapod Species common to both Mediterranean and Southern African Waters.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=42379
-
Jacques FOREST(Paris) , 1955. Crustaces Decapodes, Pagurides. In Expedition Oceanographique Belge dans les eaux cotieres africaines de l'Atlantique Sud (1948-1949). Institut Royal des Sciences Naturelles de Belgique. Volume III, Fascicule 4.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=42452
-
Türkay, M. (2001). Decapoda, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 284-292
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1392
-
Borges, P.A.V., Costa, A., Cunha, R., Gabriel, R., Gonçalves, V., Martins, A.F., Melo, I., Parente, M., Raposeiro, P., Rodrigues, P., Santos, R.S., Silva, L., Vieira, P. & Vieira, V. (Eds.) (2010). A list of the terrestrial and marine biota from the Azores. Princípia, Oeiras, 432 pp.
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149079
-
Galil, B.; Goren, M.; Mienis, H. (2011). Checklist of marine species in Israel. Compiled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=149096
-
Koukouras, Athanasios. (2010). Check-list of marine species from Greece. Aristotle University of Thessaloniki. Assembled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=142068
-
El Lakhrach, H., Hattour, A. 2010. Répartition des Crustacés Décapodes dans le Golfe de Gabès. Rapp. Comm. int. Mer Médit., 39.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=164091
Trusted
Ecology
Habitat
Known from seamounts and knolls
-
Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145453
Trusted
Depth range based on 46 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.
Environmental ranges
Depth range (m): 0 - 250.5
Temperature range (°C): 13.984 - 21.879
Nitrate (umol/L): 0.103 - 7.522
Salinity (PPS): 35.345 - 38.608
Oxygen (ml/l): 4.335 - 5.426
Phosphate (umol/l): 0.056 - 0.567
Silicate (umol/l): 1.143 - 7.751
Graphical representation
Depth range (m): 0 - 250.5
Temperature range (°C): 13.984 - 21.879
Nitrate (umol/L): 0.103 - 7.522
Salinity (PPS): 35.345 - 38.608
Oxygen (ml/l): 4.335 - 5.426
Phosphate (umol/l): 0.056 - 0.567
Silicate (umol/l): 1.143 - 7.751
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 9 samples.
Environmental ranges
Depth range (m): 0 - 250.5
Temperature range (°C): 13.984 - 21.879
Nitrate (umol/L): 0.103 - 7.522
Salinity (PPS): 35.345 - 38.608
Oxygen (ml/l): 4.335 - 5.426
Phosphate (umol/l): 0.056 - 0.567
Silicate (umol/l): 1.143 - 7.751
Graphical representation
Depth range (m): 0 - 250.5
Temperature range (°C): 13.984 - 21.879
Nitrate (umol/L): 0.103 - 7.522
Salinity (PPS): 35.345 - 38.608
Oxygen (ml/l): 4.335 - 5.426
Phosphate (umol/l): 0.056 - 0.567
Silicate (umol/l): 1.143 - 7.751
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Dardanus arrosor
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 12 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 12 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TACACTTTATTTTATTTTTGGGGCATGAGCGGGGATAGTAGGTACCTCTCTTAGTTTGATTATTCGAGCAGAGCTTGGACAGCCAGGTAGATTAATCGGAGACGATCAAATTTACAATGTAGTTGTTACAGCACATGCTTTTGTTATAATTTTTTTTATAGTTATACCGATTATGATCGGGGGGTTTGGAAATTGACTTGTTCCTCTTATATTAGGAGCTCCTGATATAGCATTTCCGCGGATAAATAATATAAGATTTTGACTATTACCTCCCTCACTAACCCTTTTATTGATAAGAGGAATAGTAGAGAGAGGAGTTGGAACTGGCTGGACAGTGTATCCTCCCTTAGCAGCTGCTATTGCTCACGCAGGCGCCTCTGTTGATATGGGAATTTTTTCTCTTCACTTAGCAGGGGTTTCTTCTATTCTAGGTGCAATTAATTTTATGACTACGGTTATTAATATACGCCCTCGGGGAATAAGGATAGACCGTATGCCACTCTTTGTTTGATCTGTTTTTATTACAGCGATTCTTTTACTGCTATCTTTGCCAGTTCTCGCGGGGGCAATTACAATGTTGTTAACAGATCGAAATCTTAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTGTCTTATACCAACATTTATTT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Dardanus arrosor
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 16
Species With Barcodes: 1
Public Records: 11
Specimens with Barcodes: 16
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
