Overview

Distribution

Azores Exclusive Economic Zone, East American Coast, East Atlantic, East Mediterranean, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Gabès, Israeli part of the Mediterranean Sea - Eastern Basin, Japan, Madagascar, Mediterranean Sea, New Zealand, Philippines, Red Sea, South Africa (country), South East Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 46 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 0 - 250.5
  Temperature range (°C): 13.984 - 21.879
  Nitrate (umol/L): 0.103 - 7.522
  Salinity (PPS): 35.345 - 38.608
  Oxygen (ml/l): 4.335 - 5.426
  Phosphate (umol/l): 0.056 - 0.567
  Silicate (umol/l): 1.143 - 7.751

Graphical representation

Depth range (m): 0 - 250.5

Temperature range (°C): 13.984 - 21.879

Nitrate (umol/L): 0.103 - 7.522

Salinity (PPS): 35.345 - 38.608

Oxygen (ml/l): 4.335 - 5.426

Phosphate (umol/l): 0.056 - 0.567

Silicate (umol/l): 1.143 - 7.751
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dardanus arrosor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACACTTTATTTTATTTTTGGGGCATGAGCGGGGATAGTAGGTACCTCTCTTAGTTTGATTATTCGAGCAGAGCTTGGACAGCCAGGTAGATTAATCGGAGACGATCAAATTTACAATGTAGTTGTTACAGCACATGCTTTTGTTATAATTTTTTTTATAGTTATACCGATTATGATCGGGGGGTTTGGAAATTGACTTGTTCCTCTTATATTAGGAGCTCCTGATATAGCATTTCCGCGGATAAATAATATAAGATTTTGACTATTACCTCCCTCACTAACCCTTTTATTGATAAGAGGAATAGTAGAGAGAGGAGTTGGAACTGGCTGGACAGTGTATCCTCCCTTAGCAGCTGCTATTGCTCACGCAGGCGCCTCTGTTGATATGGGAATTTTTTCTCTTCACTTAGCAGGGGTTTCTTCTATTCTAGGTGCAATTAATTTTATGACTACGGTTATTAATATACGCCCTCGGGGAATAAGGATAGACCGTATGCCACTCTTTGTTTGATCTGTTTTTATTACAGCGATTCTTTTACTGCTATCTTTGCCAGTTCTCGCGGGGGCAATTACAATGTTGTTAACAGATCGAAATCTTAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTGTCTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dardanus arrosor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!