Molecular Biology and Genetics

Molecular Biology

Barcode data: Penicillium chrysogenum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AAATGCAAAAGATATAGGTACTTTATACTTAATGTTTGCATTATTTTCAGGTTTAGTTGGAACAGCATTTTCAGTTTTAATTAGATTAGAATTATCTGGTCCAGGAGTACAATATATATCAGATAATCAATTATATAATAGTATAATTACAGCACATGCTATATTAATGATTTTCTTTATGGTTATGCCTGCATTAATAGGAGGTTTTGGTAATTTCTTATTACCATTATTAGTAGGAGGTCCAGATATGGCATTTCCTAGATTAAATAATATTAGTTTCTGATTATTAGTTCCTAGTTTATTTTTATTTATATTCTCAGCTACTATAGAAAATGGAGCTGGTACAGGTTGAACATTATATCCACCGTTATCAGGAATACAATCTCACAGTGGTCCTAGTGTAGACTTAGCTATTTTTGGTTTACATTTAAGTGGTATTAGTAGTATGTTAGGTGCTATGAATTTTATAACTACTATATTAAATATGAGAAGTCCTGGTATACGTTTACATAAATTAGCTTTATTTGGATGAGCTGTTATTATTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Penicillium chrysogenum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Penicillium chrysogenum

Penicillium chrysogenum is a fungus, common in temperate and subtropical regions and can be found on salted food products,[1] but it is mostly found in indoor environments, especially in damp or waterdamaged buildings.[2] It was previously known as Penicillium notatum.[3] It has rarely been reported as a cause of human disease. It is the source of several β-lactam antibiotics, most significantly penicillin. Other secondary metabolites of P. chrysogenum include various penicillins, roquefortine C, meleagrin, chrysogine, xanthocillins, secalonic acids, sorrentanone, sorbicillin, and PR-toxin.[4]

Like the many other species of the genus Penicillium, P. chrysogenum usually reproduces by forming dry chains of spores (or conidia) from brush-shaped conidiophores. The conidia are typically carried by air currents to new colonisation sites. In P. chrysogenum the conidia are blue to blue-green, and the mold sometimes exudes a yellow pigment. However, P. chrysogenum cannot be identified based on colour alone. Observations of morphology and microscopic features are needed to confirm its identity and DNA sequencing is essential to distinguish it from closely related species such as Penicillium rubens. The sexual stage of P. chrysogenum was discovered in 2013 by mating cultures in the dark on oatmeal agar supplemented with biotin, after the mating types (MAT1-1 or MAT1-2) of the strains had been determined using PCR amplification.[5]

The airborne asexual spores of P. chrysogenum are important human allergens. Vacuolar and alkaline serine proteases have been implicated as the major allergenic proteins.[6]

P. chrysogenum has been used industrially to produce penicillin and xanthocillin X, to treat pulp mill waste, and to produce the enzymes polyamine oxidase, phospho-gluconate dehydrogenase, and glucose oxidase.[4][7]

Science and history[edit]

The discovery of penicillin ushered in a new age of antibiotics derived from microorganisms. Penicillin is an antibiotic isolated from growing Penicillium mold in a fermenter. The mold is grown in a liquid culture containing sugar and other nutrients including a source of nitrogen. As the mold grows, the sugar is used up and starts to make penicillin only after using up most of the nutrients for growth.

Penicillin was discovered in 1928 when Alexander Fleming's lab assistant left a window open overnight and had mold spores cover his Staphylococcus bacterial specimens in a petri dish.[8][9] At first, Fleming was very irritated at the contamination, but, as he was about to throw the specimens away, he noticed something interesting. He looked under the microscope at the bacteria surrounding the blue-green mold and noticed that many were dead or dying. This later turned out to have been due to the mold's prevention of the bacteria from making new cell walls and reproducing. He identified the mold as Penicillium notatum, which releases the antibiotic penicillin G into the medium. (This identification has been subsequently shown to be incorrect: the fungal species was actually Penicillium rubens).[10] After this, he did some testing on humans and animals and discovered that not only did it kill bacteria but it was suitable for use as a medication in humans and animals. However, the discovery did not attract much attention until the 1940s, when Howard Florey, Norman Heatley, and Ernst Chain developed methods for mass production and application in humans, incited by the urgent war-time need for antibacterial agents. The work of Andrew J. Moyer was important in these early developments.

At this point, though the drug had shown success in treating numerous bacterial diseases, it was still so difficult to produce and so dilute that it was not feasible to produce quantities large enough for mass production, and so an effort was begun to find a strain of Penicillium with a higher rate of production of penicillin. Army pilots sent back soil from around the world to be tested for the right kind of mold.[citation needed] Even the people of Peoria, Illinois were told to bring in any molds that they found around their homes.[citation needed] It has also been said[where?] that the scientists working on this project kept an eye out for similar-looking molds while grocery shopping or when they were cleaning around the kitchen especially their refrigerators.[citation needed]

It was by these means that Penicillium chrysogenum was discovered, on a cantaloupe from a grocery store in Peoria, Illinois.[11] The fungus isolated from this cantaloupe produced several hundred times as much penicillin as Fleming's original cultures of Penicillium notatum. Subcultures of this fungus were then irradiated with X-rays and UV rays in an attempt to cause a mutation in the fungus that would lead to an increase in penicillin yield. The effort was successful, and a mutant strain that yielded more than a thousand times the penicillin of Fleming's original culture was produced and cultured.[citation needed] This discovery, in combination with vastly improved methods of culturing the fungus based on the principle of aerating the culture medium, resulted in the ability to mass-produce penicillin in quantities great enough for distribution and mass use in the United States Army, and later within the British armed service and hospitals, in WWII.

Genetics and evolution[edit]

The ability to produce penicillin appears to have evolved over thousands of years, and is shared with several other related fungi. It is believed to confer a selective advantage during competition with bacteria for food sources.[citation needed] However, some bacteria have developed the ability to survive penicillin exposure by producing penicillinases, enzymes that degrade penicillin.[citation needed] Penicillinase production is one mechanism by which bacteria can become penicillin resistant.

The principal genes responsible for producing penicillin, pcbAB, pcbC and penDE are closely linked, forming a cluster on chromosome I.[12] Some high-producing Penicillium chrysogenum strains used for the industrial production of penicillin have been shown to have multiple tandem copies of the penicillin gene cluster.[13]

References[edit]

  1. ^ Samson RA, Houbraken J, Thrane U, Frisvad JC & Andersen B. (2010). Food and Indoor Fungi. CBS-KNAW- Fungal Biodiversity Centre, Utrecht, the Netherlands. pp. 1-398.
  2. ^ Andersen B, Frisvad JC, Søndergaard I, Rasmussen IS & Larsen LS. 2011. Associations between fungal species and water damaged building materials. Applied and Environmental Microbiology. In Press
  3. ^ Samson RA, Hadlok R, Stolk AC (1977). "A taxonomic study of the Penicillium chrysogenum series". Antonie van Leeuwenhoek 43 (2): 169–175. doi:10.1007/BF00395671. PMID 413477. 
  4. ^ a b de Hoog GS, Guarro J, Gené J, Figueras F (2000), Atlas of Clinical Fungi - 2nd Edition, Centraalbureau voor Schimmelcultures (Utrecht) 
  5. ^ Böhm J, Hoff B, O’Gorman CM, Wolfers S, Klix V, Binger B, Zadra I, Kürnsteiner H, Pöggeler S, Dyer PS, Kückde U (2013), Sexual reproduction and mating-type–mediated strain development in the penicillin-producing fungus Penicillium chrysogenum, Proc. Natl. Acad. Sci. U.S.A., PNAS Early Edition, doi:10.1073/pnas.1217943110, PMC 3557024, PMID 23307807 
  6. ^ Shen HD, Chou H, Tam MF, Chang CY, Lai HY, Wang SR (2003). "Molecular and immunological characterization of Pen ch 18, the vacuolar serine protease major allergen of Penicillium chrysogenum". Allergy 58 (10): 993–1002. doi:10.1034/j.1398-9995.2003.00107.x. PMID 14510716. 
  7. ^ Raper KB, Thom C (1949), A manual of the Penicillia, Williams & Wilkins Company (Baltimore) 
  8. ^ Diggins F (1999). "The true history of the discovery of penicillin, with refutation of the misinformation in the literature". Br J Biomed Sci 56 (2): 83–93. PMID 10695047. 
  9. ^ Ligon B (2004). "Penicillin: its discovery and early development". Semin Pediatr Infect Dis 15 (1): 52–7. doi:10.1053/j.spid.2004.02.001. PMID 15175995. 
  10. ^ Houbraken, J; Frisvad, JC; Samson, RA (2011). "Fleming's penicillin producing strain is not Penicillium chrysogenum but P. rubens". IMA Fungus 2 (1): 87–95. doi:10.5598/imafungus.2011.02.01.12. PMC 3317369. PMID 22679592. 
  11. ^ http://www.ars.usda.gov/is/timeline/penicillin.htm
  12. ^ Martín JF, Gutiérrez S, Fernández FJ, et al. (1994). "Expression of genes and processing of enzymes for the biosynthesis of penicillins and cephalosporins". Antonie Van Leeuwenhoek 65 (3): 227–243. doi:10.1007/BF00871951. PMID 7847890. 
  13. ^ Fierro F, Barredo JL, Díez B, Gutierrez S, Fernández FJ, Martín JF (1995). "The penicillin gene cluster is amplified in tandem repeats linked by conserved hexanucleotide sequences". Proc. Natl. Acad. Sci. U.S.A. 92 (13): 6200–6204. doi:10.1073/pnas.92.13.6200. PMC 41670. PMID 7597101. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Penicillium chrysogenum

Penicillium chrysogenum is a mold that is widely distributed in nature, and is often found living on foods and in indoor environments. It was previously known as Penicillium notatum.[1] It has rarely been reported as a cause of human disease. It is the source of several β-lactam antibiotics, most significantly penicillin. Other secondary metabolites of P. chrysogenum include various different penicillins, roquefortine C, meleagrin, chrysogine, xanthocillins, secalonic acids, sorrentanone, sorbicillin, and PR-toxin.[2]

Like the many other species of the genus Penicillium, P. chrysogenum reproduces by forming dry chains of spores (or conidia) from brush-shaped conidiophores. The conidia are typically carried by air currents to new colonisation sites. In P. chrysogenum the conidia are blue to blue-green, and the mold sometimes exudes a yellow pigment. However, P. chrysogenum cannot be identified based on colour alone. Observations of morphology and microscopic features are needed to confirm its identity.

The airborne spores of P. chrysogenum are important human allergens. Vacuolar and alkaline serine proteases have been implicated as the major allergenic proteins. [3]

P. chrysogenum has been used industrially to produce penicillin and xanthocillin X, to treat pulp mill waste, and to produce the enzymes polyamine oxidase, phospho-gluconate dehydrogenase, and glucose oxidase.[2][4]

Contents

Science and History

Penicillin was discovered in 1928 when Alexander Fleming's lab assistant left a window open overnight and had mold spores cover his Staphylococcus bacterial specimens in a petri dish.[5][6] At first he was very irritated at the contamination but as he was about to throw the specimens away, he noticed something interesting. He looked under the microscope at the bacteria surrounding the blue-green mold and noticed that many were dead or dying due to the mold preventing the bacteria from making new cell walls and reproducing. He identified the mold as Penicillium notatum, which releases the antibiotic penicillin G into the medium. After this he did some testing on humans and animals and discovered that not only did it kill bacteria, but that it was suitable for use in humans and animals. However, the discovery did not attract much attention until the 1940s when Howard Florey, Norman Heatley and Ernst Chain developed methods for mass production and application in humans, incited by the urgent war-time need for antibacterial agents. At this point, though the drug had shown success in treating numerous bacterial diseases, it was still so difficult to produce and so dilute that it was not feasible to produce quantities large enough for mass production, and so an effort was begun to find a strain of Penicillium with a higher rate of production of penicillin. Army pilots sent back soil from around the world to be tested for the right kind of mold. Even the people of Peoria, Illinois were told to bring in any molds that they found around their homes. It has also been said that the scientists working on this project kept an eye out for similar looking molds while grocery shopping or when they were cleaning around the kitchen especially their refrigerators. It was by these means that Penicillium chrysogenum was discovered, on a cantaloupe from a grocery store in Peoria, Illinois. The fungus isolated from this cantaloupe produced several hundred times as much penicillin as Flemming's original cultures of Penicillium notatum. Subcultures of this fungus were then irradiated with X-rays and UV rays in an attempt to cause a mutation in the fungus that would lead to an increase in penicillin yield. The effort was successful, and a mutant strain was produced and cultured which yielded more than a thousand times the penicillin of Fleming's original culture. This discovery, in combination with vastly improved methods of culturing the fungus based on the principle of aerating the culture medium, resulted in the ability to mass produce penicillin in quantities great enough for distribution and mass use in the Army in WWII. The discovery of penicillin ushered in a new age of antibiotics derived from microorganisms. Penicillin is an antibiotic made by growing the mold Penicillium chrysogenum in a fermenter. The mold is grown in a liquid culture containing sugar and other nutrients (for example a source of nitrogen). As the mold grows, the sugar is used up and only starts to make penicillin after using up most of the nutrients for growth.

Genetics and Evolution

The ability to produce penicillin appears to have evolved over thousands of years, and is shared with several other related fungi. It is believed to confer a selective advantage during competition with bacteria for food sources. However, some bacteria have developed the ability to survive penicillin exposure by producing penicillinases, enzymes that degrade penicillin. Penicillinase production is one mechanism by which bacteria can become penicillin resistant.

The principal genes responsible for producing penicillin, pcbAB, pcbC and penDE are closely linked, forming a cluster on chromosome I.[7] Some high-producing Penicillium chrysogenum strains used for the industrial production of penicillin have been shown to have multiple tandem copies of the penicillin gene cluster.[8]

References

  1. ^ Samson RA, Hadlok R, Stolk AC (1977). "A taxonomic study of the Penicillium chrysogenum series". Antonie van Leeuwenhoek 43 (2): 169–175. doi:10.1007/BF00395671. PMID 413477. 
  2. ^ a b de Hoog GS, Guarro J, Gené J, Figueras F (2000), Atlas of Clinical Fungi - 2nd Edition, Centraalbureau voor Schimmelcultures (Utrecht) 
  3. ^ Shen HD, Chou H, Tam MF, Chang CY, Lai HY, Wang SR (2003). "Molecular and immunological characterization of Pen ch 18, the vacuolar serine protease major allergen of Penicillium chrysogenum". Allergy 58 (10): 993–1002. doi:10.1034/j.1398-9995.2003.00107.x. PMID 14510716. 
  4. ^ Raper KB, Thom C (1949), A manual of the Penicillia, Williams & Wilkins Company (Baltimore) 
  5. ^ Diggins F (1999). "The true history of the discovery of penicillin, with refutation of the misinformation in the literature". Br J Biomed Sci 56 (2): 83–93. PMID 10695047. 
  6. ^ Ligon B (2004). "Penicillin: its discovery and early development". Semin Pediatr Infect Dis 15 (1): 52–7. doi:10.1053/j.spid.2004.02.001. PMID 15175995. 
  7. ^ Martín JF, Gutiérrez S, Fernández FJ, et al. (1994). "Expression of genes and processing of enzymes for the biosynthesis of penicillins and cephalosporins". Antonie Van Leeuwenhoek 65 (3): 227–243. doi:10.1007/BF00871951. PMID 7847890. 
  8. ^ Fierro F, Barredo JL, Díez B, Gutierrez S, Fernández FJ, Martín JF (1995). "The penicillin gene cluster is amplified in tandem repeats linked by conserved hexanucleotide sequences". Proc. Natl. Acad. Sci. U.S.A. 92 (13): 6200–6204. doi:10.1073/pnas.92.13.6200. PMID 7597101. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!